Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

What does 'prevention of nontemplate-directed nucleotide addition' mean?


  • Please log in to reply
3 replies to this topic

#1 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 963 posts
42
Excellent

Posted 22 November 2012 - 02:16 AM

A friend of mine asked me a question I couldn't answer. He gave me a paper (as attached) and asked me why there is a ctgtctt tail on every reverse primers (Table 2). The paper is about STRs, which is not really my area of expertise.

example:
F: 6-FAM TCAACTGTTGGAAGGGCAAT
R: ctgtcttTTGCTGCGTTTTTGTTTCTG

In the legend of Table 2 it reads " The CTGTCTT tail (lowercase letters) was added to the 5' end of reverse primers to either promote or prevent nontemplate-directed nucleotide addition (+A) to the PCR products in a reproducible way". The authors use premium taq which will add A to the ends of PCR product, but how can ctgtctt prevent that?

Apparently after PCR they analyse the product with an ABI machine.

Attached Files



#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 943 posts
66
Excellent

Posted 22 November 2012 - 07:26 AM

PCR of repeats is used to measure their length, which is highly polymorphic. But since Taq ads additional A at the end in presumably (from the paper) unpredictible manner, and together with the fact that polymerase may slip on the repeats, it then creates multiple products from one reaction, differing around that one nucleotide.
Products are marked by fluorescent fwd primer and analysed in capillary electrophoresis (similar as sequencing). But the you got multiple signals for one length and if you are looking into dinucleotide repeats for example, it's really difficult to measure the right length then.
This is for the explanation why this is needed.

This seems to be the original paper about the added A.

Maybe more will be found in key papers about STR polymorfisms, like this one maybe, but I don't have the access. Validation of short tandem repeats (STRs) for forensic usage: performance testing of fluorescent multiplex STR systems and analysis of authentic and simulated forensic samples.
But from search seems, that adding tails (not just this particular sequence) is a common thing in STR amplification.
Keep me posted if you find out ;)
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#3 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 963 posts
42
Excellent

Posted 23 November 2012 - 12:10 AM

Thanks Trof, I sent your reply to my friend. I don't have time to read the papers today, but I also want to find out if the sequence of the tail is important or not....or it can be anything?

#4 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 943 posts
66
Excellent

Posted 23 November 2012 - 01:37 AM

I think the paper states, the tail makes the A adding more reproducible instead of just simply abrogating it, so the mechanism may be really complex.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.