Hello!
I have been trying to clone a 3Kb pcr product into a TOPO vector. I have tried the standard protocol given with my vector kit many a times. This protocol includes:
1. Pcr amplification of desired gene with phusion (NEB)
2. gel extraction using qiagen kit
3. addition of "A" using taq polymerase (openwetware protocol) at 72 degree for 20 mins
4. ligation using TOPO vector for 30 mins at RT
5. transformation using TOP10 competent cells at 42 for 45 secs.
6. addition of 250ul SOC to this mixture, incubating shaking at 37/1hour
7. plating the transformants on LA+Amp.
I tried this procedure many a times and got very small satellite colonies. These colonies very small and did not grow in LB + Amp.
One fine day i followed the same procedure and again got small colonies like before. I picked few of these small colonies and grew them in LB+Amp for 4-5 hours. As expected, there was no growth. BUT after one day ie after 24 hours there was growth in this LB+Amp and also on my plate (LA+Amp) the small colonies had increased in size. Initially i thought that this must be some contamination. So to test this, i innoculated 15ml LB+AMP with small innoculum. I got growth in 2 hours.
I am planning to isolate plasmid from these cells and check for my clone. BUT before i do that i need an expert advice on the possibility of these colonies being the desired transformants.
KIndly help and please reply as soon as possible
Regards
Mansi
surprising behavior of transformants needs immediate advice!
Started by mansi368, Oct 24 2012 06:29 AM
8 replies to this topic
#1
Posted 24 October 2012 - 06:29 AM
#2
Posted 24 October 2012 - 06:33 AM
For the information of the reader: The ampicillin stock vial used is fresh and appropriately made as 100ug/ml.
Thanks again
Thanks again
#3
Posted 24 October 2012 - 12:42 PM
It could be that the topoisomerase on the vector has gone off. Is the kit relatively new?
It could also be that your transformation protocol is not the most efficient - it is quite dependent on the tubes that you are using for the heat shock step as to how long you should shock for. Using eppendorf 1.5 ml tubes I shock for 1 min.
It is also possible that the addition of the A overhang is being inhibited by some carry-over from the gel extraction - you shouldn't need to do a gel extract if your PCR is specific enough.
Satellite colonies are colonies found around a main colony on a plate, small colonies are just small colonies...
It could also be that your transformation protocol is not the most efficient - it is quite dependent on the tubes that you are using for the heat shock step as to how long you should shock for. Using eppendorf 1.5 ml tubes I shock for 1 min.
It is also possible that the addition of the A overhang is being inhibited by some carry-over from the gel extraction - you shouldn't need to do a gel extract if your PCR is specific enough.
Satellite colonies are colonies found around a main colony on a plate, small colonies are just small colonies...
#4
Posted 24 October 2012 - 11:00 PM
@ bob1
Thanks for your reply. I isolated plasmid from these small colonies grown in broth + amp. it gave me a concentration of 0.1ug/ml. A260 = 0.001 and A280 = -0.003. I think this is not the plasmid.
The kit is very new and i have no idea as to how topoisomerase could go off? I get many bands in pcr which is why i have to do gel extraction of my desired band. I have even tried to give heat shock for 1 min but still no colonies.
I am unable to troubleshoot as to where the problem is?
Thanks for your reply. I isolated plasmid from these small colonies grown in broth + amp. it gave me a concentration of 0.1ug/ml. A260 = 0.001 and A280 = -0.003. I think this is not the plasmid.
The kit is very new and i have no idea as to how topoisomerase could go off? I get many bands in pcr which is why i have to do gel extraction of my desired band. I have even tried to give heat shock for 1 min but still no colonies.
I am unable to troubleshoot as to where the problem is?
#5
Posted 25 October 2012 - 12:44 PM
I agree that the small colonies probably aren't plasmid containing - absorbance measurements will show ANY nucleotides present in your isolation, as well as proteins and a whole heap of other things that absorb at the same wavelengths. You should check any plasmid isolation by running the plasmid on a gel to check for integrity of the isolated DNA and contamination with genomic DNA. However, for your samples you don't need to do this at the moment as you 1) won't have enough DNA to see, and 2) it almost certainly isn't plasmid DNA that you have isolated.
How have you optimised your PCR? You should at least be able to get it down to a few bands with the right conditions, unless your primers are particularly short.
Do you have a positive control reaction for the transformation?
Topoisomerase, like any other enzyme can easily be degraded by temperature and freeze/thaw cycles. Follow the kit storage instructions, and make sure you keep the tubes on ice when thawed.
If you can post a complete protocol for all your steps, that will help diagnose the problem - it is very likely a simple mistake that you are making.
How have you optimised your PCR? You should at least be able to get it down to a few bands with the right conditions, unless your primers are particularly short.
Do you have a positive control reaction for the transformation?
Topoisomerase, like any other enzyme can easily be degraded by temperature and freeze/thaw cycles. Follow the kit storage instructions, and make sure you keep the tubes on ice when thawed.
If you can post a complete protocol for all your steps, that will help diagnose the problem - it is very likely a simple mistake that you are making.
#6
Posted 25 October 2012 - 02:10 PM
I'd suggest simplifying your protocol by doing a PCR with Taq rather than Phusion, which will leave the A overhangs without an extra step. How are your competent cells made? How competent are they? Have you measured their competence?
#7
Posted 25 October 2012 - 10:15 PM
I have tried amplifying 3kb with taq polymerase (fermentas) but i have never got any amplification. My primers are 23 (f) and 20 ® nts long. I usually give an extension time for 2 minutes. Can u suggest any other changes by which i can get this product. My primer sequences are
Fwd: 5’ ACATGCTTTGGGACTGCCACTGA 3’
Rev: 5’ GCCGGCAATGGACGTGAACA 3’
I am using 1x buffer, 25mM mgcl2, 1.25ul primers, 0.25mM dntp, 1U/ul Taq, 1ul template for a 25ul reaction
Please suggest
Thanks
Fwd: 5’ ACATGCTTTGGGACTGCCACTGA 3’
Rev: 5’ GCCGGCAATGGACGTGAACA 3’
I am using 1x buffer, 25mM mgcl2, 1.25ul primers, 0.25mM dntp, 1U/ul Taq, 1ul template for a 25ul reaction
Please suggest
Thanks
#8
Posted 25 October 2012 - 11:26 PM
25 mM MgCl2 is a lot - standard PCR is usuallydone with 1.5 mM. The volumes mean nothing without concentrations (e.g how much DNA is 1 ul? and is it from genomic DNA, cDNA, plasmid...?). What is your annealing temperature? And concentrations of starting buffers mean nothing at all without volumes or final concentrations.
You primers probably have quite different Tm's as they are 70 and 64 respectively. You might be best off designing new primers to make the PCR more specific.
You primers probably have quite different Tm's as they are 70 and 64 respectively. You might be best off designing new primers to make the PCR more specific.
#9
Posted 26 October 2012 - 01:42 PM
As Bob1 said, your Mg concentration is way too high. If you can find a master mix for PCR reactions, it will be easier and less error prone than making your own reaction mix. What is the primer concentration? Think in terms of final molarity of these components, not in microliters (which tells you nothing about the amount used).
Also, what PCR program are you using?
Also, what PCR program are you using?













