Hi all,
I've performed some degrees of cloning before but I never really understood how you could check whether or not your insert is 'in-frame'?
Previously when I cloned, I would get a blunt PCR product which I did a blunt end ligation into a TOPO vector. Then, I used a restriction enzyme
that cut my insert ouf of the TOPO vector, clipped another vector, and ligated that together. Professors have always told me to check to make sure that my insert goes in 'in-frame', but how would I do that in terms of designing my primer?
If I use the digest-ligation method like I mentioned above, would you assume that it's going in frame?
Explanation of "In-Frame" cloning?
Started by Christopher Yip, Oct 20 2012 01:58 PM
In Frame ORF Cloning Vector
6 replies to this topic
#1
Posted 20 October 2012 - 01:58 PM
#2
Posted 20 October 2012 - 03:01 PM
Do you clone the gene that has a complete sequence from start codon to stop codon and you don't have any tags that would be fused to your gene on either sides? In that case I think you don't need to care about in-frame cloning, because the cloned fragment caries the whole coding frame.
But if you insert a part of gene after ATG, or have to place it between tags, you to do it in a way that maintains ORF frame. If you shift the frame, the DNA sequence would be read in wrong codons and resulting protein would be completely different (or in case of terminal tag, the tag would be out of frame).
Like you have this sequence of your gene
5' - GTCAATGGGACGTACATTCTGGCTCGCTCTGTAGGGCT - 3'
The start codon is bold, the stop codon is underlined, and the codons have alternating color.
Now you have a plasmid with these ends, containg already a start codon, terminal tag and it's own stop codon.
--GCCTTAATG - 3' 5' - CACCACCACCACCACTAGGGCTACCTG-- (tag is with alternating green)
Now if you want to clone your gene to this plasmid (say it's blunt you need to design primers, so they will have complete in-frame tri-nucleotide on the ends, like this, but of course not including the original stop codon of your gene:
--GCCTTAATGCGTACATTCTGGCTCGCTCTGCACCACCACCACCACTAGGGCTACCTG-- you see that the frame is correct from start to end. But if you make the product one base short on the right side:
--GCCTTAATGGTACATTCTGACTCGCTCTGCACCACCACCACCACTAGGGCTACCTG-- now the frame is destoyed, the codons are completely different and even the stop codon was lost
But if you insert a part of gene after ATG, or have to place it between tags, you to do it in a way that maintains ORF frame. If you shift the frame, the DNA sequence would be read in wrong codons and resulting protein would be completely different (or in case of terminal tag, the tag would be out of frame).
Like you have this sequence of your gene
5' - GTCAATGGGACGTACATTCTGGCTCGCTCTGTAGGGCT - 3'
The start codon is bold, the stop codon is underlined, and the codons have alternating color.
Now you have a plasmid with these ends, containg already a start codon, terminal tag and it's own stop codon.
--GCCTTAATG - 3' 5' - CACCACCACCACCACTAGGGCTACCTG-- (tag is with alternating green)
Now if you want to clone your gene to this plasmid (say it's blunt you need to design primers, so they will have complete in-frame tri-nucleotide on the ends, like this, but of course not including the original stop codon of your gene:
--GCCTTAATGCGTACATTCTGGCTCGCTCTGCACCACCACCACCACTAGGGCTACCTG-- you see that the frame is correct from start to end. But if you make the product one base short on the right side:
--GCCTTAATGGTACATTCTGACTCGCTCTGCACCACCACCACCACTAGGGCTACCTG-- now the frame is destoyed, the codons are completely different and even the stop codon was lost
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.
I never trust anything that can't be doubted.
I never trust anything that can't be doubted.
#3
Posted 20 October 2012 - 07:38 PM
I'm actually putting a flourescent tag on my protein so my tag will have the start codon, and continue to run all the way to the end of my insert where the stop codon is.
Let's say my tag and gene are shown below, respectively.
5'- ATG CTG GTG ... AGA AGT TGT - 3'; 5'- ATG GGC GTG ... GGG TTT TAG
I'm going to design my primer such that it will hybrize the two genes together in later PCRs, so I put an overhang on my tag's reverse primer that is complementary to the the beginning of the desired insert's sequence:
(Tag Reverse primer)
5'- CAC CGC CAT ACA ACT TCT - 3'
I'm putting it into the TOPO zero blunt end vector, which I don't think is going to be a problem in terms of in-frame (if I understand it correctly) since there's a topoisomerase that just sorta unwinds my PCR strands in. Here's the map of the vector (page 18): http://tools.invitro...unttopo_man.pdf
My question is that, after I put it into the TOPO vector, which I'm pretty sure will go 'in frame', can I digest the TOPO vector with ECORI since it flanks my insert, and place that into another vector that has a multiple cloning site for ECORI.
Thanks for your quick reply, by the way
Let's say my tag and gene are shown below, respectively.
5'- ATG CTG GTG ... AGA AGT TGT - 3'; 5'- ATG GGC GTG ... GGG TTT TAG
I'm going to design my primer such that it will hybrize the two genes together in later PCRs, so I put an overhang on my tag's reverse primer that is complementary to the the beginning of the desired insert's sequence:
(Tag Reverse primer)
5'- CAC CGC CAT ACA ACT TCT - 3'
I'm putting it into the TOPO zero blunt end vector, which I don't think is going to be a problem in terms of in-frame (if I understand it correctly) since there's a topoisomerase that just sorta unwinds my PCR strands in. Here's the map of the vector (page 18): http://tools.invitro...unttopo_man.pdf
My question is that, after I put it into the TOPO vector, which I'm pretty sure will go 'in frame', can I digest the TOPO vector with ECORI since it flanks my insert, and place that into another vector that has a multiple cloning site for ECORI.
Thanks for your quick reply, by the way
#4
Posted 21 October 2012 - 01:49 AM
Ok so you are amplifing the tag from one source and the rest of insert from another and linking it together. I know it's just a schematic, but I tried to link it.
5'- ATG CTG GTG ... AGA AGT TGT - 3' -tag
||| ||| |||
3' - TCT TCA ACA TAC CCG CAC - 5' -Tag rev primer (reverse orientation)
||| ||| |||
5'- ATG GGC GTG ... GGG TTT TAG - 3' - gene
The joined sequence would be like this (those blue underlined nucleotides doesn't match, but I suppose that was just a typo):
5'- ATG CTG GTG ... AGA AGT TGT ATG GGC GTG ... GGG TTT TAG- 3'
It is in frame, however you have two ATG codons, sometimes the second one is ommited since it's celaved from he mature protein anyway, and sometimes a spacer (like Ala-Ala-Ala) is added between tag and the protein itself to separate it so it would lower the possibility that tag affects the protein structure.
Also if you clone this particular product (so including both ATG and stop codons) to the blunt TOPO vector (the fact it uses topoisomerase isn't that important, that just increases the efficiency, important is it's blunt, so no nucleotides are added, but even if they were, they would be in this case added before ATG and after stop codon, so we don't care). Since EcoRI sites are also outside this whole frame you don't care about them either in this respect (you just care that you don't have EcoRI site inside insert sequence).
The blunt cloning can have one other problem and that is the orientation of cloned insert inside it, since it's blunt both 5'- ATG...TAG-3' and 5'- CTA...CAT-3' sequences (in the direction of the published vector sequence), so if you were using the plasmid for expression, the second orientation would be reversed (the promoter sequence present on plasmid must be near the ATG and not near the stop conodn) and actually also out-of-frame, since it's read in the oposite direction. Now that I think about it, this is what your professor was probably talking about...
This is the first case that can happen after cutting:
5'-AATTCGCCCTTATG...TAGAAGGGCG -3'
3'- GCGGGAATAC...ATCTTCCCGCTTAA-5'
And second:
5'-AATTCGCCCTTCTA...CATAAGGGCG -3'
3'- GCGGGAAGAT...GTATTCCCGCTTAA-5'
As you see in this case, sticky endy allow only one orientaion of cloning, but as you have the same sticky ends it doesn't matter which orientation you have your insert cloned in entry vector (so you have 50% for the right orientation in destination plasmid, you need to check fot the right clones then). But if those ends were different like AATT overgang on 5' and TTGG on 3' (and same on the destination plasmid) there would be just one option and so you would need to check the correct orientation already in the entry vector after blunt ligation.
5'- ATG CTG GTG ... AGA AGT TGT - 3' -tag
||| ||| |||
3' - TCT TCA ACA TAC CCG CAC - 5' -Tag rev primer (reverse orientation)
||| ||| |||
5'- ATG GGC GTG ... GGG TTT TAG - 3' - gene
The joined sequence would be like this (those blue underlined nucleotides doesn't match, but I suppose that was just a typo):
5'- ATG CTG GTG ... AGA AGT TGT ATG GGC GTG ... GGG TTT TAG- 3'
It is in frame, however you have two ATG codons, sometimes the second one is ommited since it's celaved from he mature protein anyway, and sometimes a spacer (like Ala-Ala-Ala) is added between tag and the protein itself to separate it so it would lower the possibility that tag affects the protein structure.
Also if you clone this particular product (so including both ATG and stop codons) to the blunt TOPO vector (the fact it uses topoisomerase isn't that important, that just increases the efficiency, important is it's blunt, so no nucleotides are added, but even if they were, they would be in this case added before ATG and after stop codon, so we don't care). Since EcoRI sites are also outside this whole frame you don't care about them either in this respect (you just care that you don't have EcoRI site inside insert sequence).
The blunt cloning can have one other problem and that is the orientation of cloned insert inside it, since it's blunt both 5'- ATG...TAG-3' and 5'- CTA...CAT-3' sequences (in the direction of the published vector sequence), so if you were using the plasmid for expression, the second orientation would be reversed (the promoter sequence present on plasmid must be near the ATG and not near the stop conodn) and actually also out-of-frame, since it's read in the oposite direction. Now that I think about it, this is what your professor was probably talking about...
This is the first case that can happen after cutting:
5'-AATTCGCCCTTATG...TAGAAGGGCG -3'
3'- GCGGGAATAC...ATCTTCCCGCTTAA-5'
And second:
5'-AATTCGCCCTTCTA...CATAAGGGCG -3'
3'- GCGGGAAGAT...GTATTCCCGCTTAA-5'
As you see in this case, sticky endy allow only one orientaion of cloning, but as you have the same sticky ends it doesn't matter which orientation you have your insert cloned in entry vector (so you have 50% for the right orientation in destination plasmid, you need to check fot the right clones then). But if those ends were different like AATT overgang on 5' and TTGG on 3' (and same on the destination plasmid) there would be just one option and so you would need to check the correct orientation already in the entry vector after blunt ligation.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.
I never trust anything that can't be doubted.
I never trust anything that can't be doubted.
#5
Posted 21 October 2012 - 10:40 AM
Oh eff. I didn't even think about the orientation of the blunt end ligation. Thanks a bunch!
Maybe I'm taking the part about the methionine (ATG), but I don't think I really understand the issue? The n-terminus should start with the fluorescent tag so it needs to have the start codon, ATG. Translation is going to keep running through to the end of my gene of interest since there's no stop codon on my flourescent protein. The original start codon for my gene of interest wouldn't matter would it since there would be methionines in the internal sequence of the protein?
So I just need to emphasize this question one more time because I don't want to go through rounds of cloning and then do a final transformation and find that it doesn't work, haha (I need to transform into B. subtilis and it takes an entire day
).
[Assuming that my product goes in correctly (correct orientation) via blunt end ligation]. When I digest the topo vector to retrieve my insert and my 'next vector' with the same restriction enzyme and ligate those two together, will that ensure that my insert goes in in-frame?
Maybe I'm taking the part about the methionine (ATG), but I don't think I really understand the issue? The n-terminus should start with the fluorescent tag so it needs to have the start codon, ATG. Translation is going to keep running through to the end of my gene of interest since there's no stop codon on my flourescent protein. The original start codon for my gene of interest wouldn't matter would it since there would be methionines in the internal sequence of the protein?
So I just need to emphasize this question one more time because I don't want to go through rounds of cloning and then do a final transformation and find that it doesn't work, haha (I need to transform into B. subtilis and it takes an entire day
[Assuming that my product goes in correctly (correct orientation) via blunt end ligation]. When I digest the topo vector to retrieve my insert and my 'next vector' with the same restriction enzyme and ligate those two together, will that ensure that my insert goes in in-frame?
#6
Posted 21 October 2012 - 02:42 PM
It's correct that second ATG is probably not a problem, since the first ATG after promoter (usually Kozak sequence) us used as transcrition start. However you need to consider the structure of ouyr protein, it's a 3D folded bunch. As you know all RNA must start with ATG, but not all mature proteins have the methionine as first amino acid, because sometimes it interferes with the desired structure, so it's cleaved out in mature protein.
Your fluorescent tag fusion protein will not have the chance to get rid of that metionine, because it's now not at the end, but inside. You should search in the literature to see if your protein has a mature form without Met or not. Even if it hasn't it doesn't mean your fusion protein wouldn't work, but people rather ommit it.
Also the same is about the linker between the tag and protein, some add it just to lower the change of structural interaction, because it's very difficult to tell beforehand if it has any consequence on the final protein. Some add a sequence allowing specific cleavage, just in case the spacer between the tag and protein is not enough.
I don't have much personal experience with this myself, so I would suggest searching the forums mabye or the internet for more detailed information on recombinant proteins and tags. For example I found this. I think this is pretty important to decide before you start cloning, because it would be too difficult to change it after that.
And about that again-question, if you clone a complete ORF into the TOPO vector (including stop and star codons, probably it's a good thing to thinka bout poly A signal, will you clone this sequence too or does the final vector have it?), AFAIK you need not to worry about the frame shifting, the primer you are using retains frame between tag and your protein.
About the EcoRI cloning... assuming you have the promoter sequences on your final plasmid on 5' end, then after you grow colonies in B. subtilis you have 50% probablity of case 1 (as schematic above) which has a correct direction and 50% chance of case 2, that will have the ATG codon on the oposite site than you want. But you don't need to screen the TOPO plasmid for the right orientation, because it doesn't matter, just the final one.
But it will be better if you make scheme about everything again as I did, your own and try to move the sequences and so (or probably there are some tools for that I don't know) so you will be perfectly sure yourself. I could made a mistake too, it's your protein after all, your final decision.
Your fluorescent tag fusion protein will not have the chance to get rid of that metionine, because it's now not at the end, but inside. You should search in the literature to see if your protein has a mature form without Met or not. Even if it hasn't it doesn't mean your fusion protein wouldn't work, but people rather ommit it.
Also the same is about the linker between the tag and protein, some add it just to lower the change of structural interaction, because it's very difficult to tell beforehand if it has any consequence on the final protein. Some add a sequence allowing specific cleavage, just in case the spacer between the tag and protein is not enough.
I don't have much personal experience with this myself, so I would suggest searching the forums mabye or the internet for more detailed information on recombinant proteins and tags. For example I found this. I think this is pretty important to decide before you start cloning, because it would be too difficult to change it after that.
And about that again-question, if you clone a complete ORF into the TOPO vector (including stop and star codons, probably it's a good thing to thinka bout poly A signal, will you clone this sequence too or does the final vector have it?), AFAIK you need not to worry about the frame shifting, the primer you are using retains frame between tag and your protein.
About the EcoRI cloning... assuming you have the promoter sequences on your final plasmid on 5' end, then after you grow colonies in B. subtilis you have 50% probablity of case 1 (as schematic above) which has a correct direction and 50% chance of case 2, that will have the ATG codon on the oposite site than you want. But you don't need to screen the TOPO plasmid for the right orientation, because it doesn't matter, just the final one.
But it will be better if you make scheme about everything again as I did, your own and try to move the sequences and so (or probably there are some tools for that I don't know) so you will be perfectly sure yourself. I could made a mistake too, it's your protein after all, your final decision.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.
I never trust anything that can't be doubted.
I never trust anything that can't be doubted.
#7
Posted 22 October 2012 - 11:31 AM
Thanks! I think I fully understand now
Also tagged with one or more of these keywords: In Frame, ORF, Cloning, Vector
![]() |
Protocols and Techniques Forums →
Molecular Biology →
Cloning cDNA construct into E.Coli.Started by Guest_rjiyer_* , 11 Jun 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
Molecular Cloning →
Too many negative clones using Directional TOPO CloningStarted by Guest_zbiology_* , 23 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
Genetics and Genomics →
Design construct for promoter activity assayStarted by Guest_DrLeo_* , 23 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
Molecular Cloning →
"Easiest" sticky end combinationStarted by Guest_doxorubicin_* , 21 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
Reproducible Non-Specific PCR ProductStarted by Guest_Epigeneticist_* , 20 May 2013 |
|
|














