Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

BSP Primers with M13 Tails

  • Please log in to reply
1 reply to this topic

#1 Galleg



  • Members
  • Pip
  • 4 posts

Posted 17 October 2012 - 11:19 PM

Hi folks,
First I want to thank you all for this great forum and the help I already get from here. But right now Iam a little bit lost and hope I can get specific help from you all. Iam only a diplomastudent get the big task to establish direct bisulfide sequencing in our lab and nobody is on hand to really help me.
Okay for example this is the region of interest (not converted):


I want to amplify the region between 800 and 1000 bp (use Methprime options:
Exclude Regions: 1, 750 1100, 120
Max. poly T: 3

As forward primer I design TTGATTGGTTATAAGTTTATAGTTTAG (len. 27 bp, Tm 55.12 )
As revers primer I design CTTCCACACCCACTACTAAAC (len. 21 bp, Tm 57.63)

Tm I calculate with http://www.sigma-gen...alc/DNACalc.asp because we want to order the primer from that company.

Are the primers alright so far?

To make it easier for our sequencing facility I want to use M13 Tails for the Primer. So i can also use a touchdown PCR to amplify the product.
Okay and that is the big question. If I add the M13 Tail to the primer (TGT AAA ACG ACG GCC AGT) I get really high Tm (over 70 degree ) and also extreme long Primer (about 40 bp). What should I do, cut the gen specific part of the primer to get smaller primer (but also more unspecific) or can I work which these long primers with the high Tm ? Sorry for that dumb question but as I sad Iam pretty new in these field.

Big thanks for help!


Edited by Galleg, 17 October 2012 - 11:20 PM.

#2 hobglobin


    Growing old is mandatory, growing up is optional...

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,600 posts

Posted 18 October 2012 - 08:25 AM

The M13-tail is at the 5'-end of one of the primers and is not annealing to the sample DNA (but later to the M13-sequence that is incorporated to the amplified DNA). Therefore you don't need to consider it in the calculations.
The experiments I did and also from several others I know about, used the Schuelke (2000) paper and followed all more or less his protocol and settings and did surprisingly few modifications (especially primer concentrations and lowering Ta after a the usual cycles). So I'd follow his suggestions too first.

One must presume that long and short arguments contribute to the same end. - Epicurus
...except casandra's that did belong to the funniest, most interesting and imaginative (or over-imaginative?) ones, I suppose.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.