Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

question about PCR and cloning


  • Please log in to reply
1 reply to this topic

#1 boa

boa

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 01 October 2012 - 08:11 PM

I have no clue where to start but I think it is safe to say that my forward primer could be TAC and my reverse primer TTA (complementary sequences of the start and stop codon) but I dont know what to do after...the problem seems very overwhelming to me! I would like someone to provide me some hints to tackle this!
Thanks everyone!Thank you for your help!

Question :
Write the sequence of two oligonucleotides that will allow you to clone the coding region of gene x
in the vector pQE60 using PCR . The coding sequence must be in frame with the ATG of the vector. The histidine tag must be present
at the C-terminus of your recombinant protein. The oligos must be as short as possible but must
hybridize with 20 nucleotides of the template sTrand. The start and stop codons of gene X are
underlined.

Coding sequence of gene X
GTCGATCAAT ATGGAACATG TTTACTCCAA ACCACCGCAC ACCAATTATG
GAAACCAAGC CGGAAAAGAA TTCCGGTGGA GAGCGAAAAA AAAGGATTCC
GAATCGTGAA CTGCCAAAAA CATTTTGAAG CCAACGATTC CGACGTCATC
CTCGCCACCC TAGCTAAATC AGGCACCACT TGGTTAAAAG CTCTTCTCTT
TGCTCTCATT CACCGACACA AGTTCCCAGT TTCTGGCAAG CATCCTCTTC
TGAAACAGCA GTAGCAGCGT TTAAAGGGAA GTTTATT

Oligo #1 5' ________________________________________…
Oligo #2 5' ________________________________________…

Nco1 = CCATGG BamH1 = GGATCC BglII = AGATCT HindIII = AAGCTT

pQE60 (RBS)CCATGGGAGGATCCAGATCT(blackbox) TAAGCTTCCGCATAATTAGCTGAG
Additional Details
The start and stop codons of gene X are the first ATG and the last TAA

underlined in vector pqe60: the first ATG

#2 susnata

susnata

    member

  • Active Members
  • Pip
  • 10 posts
0
Neutral

Posted 26 July 2013 - 01:28 AM

your forward primer would be exactly the same sequence of gene x given... u just need to select some 20 bases upstream of your ATG sequence .. n it is your forward primer.

for your reverse primer.. you got to select the last 20bases of your geneX which would include the stop codon. then you got to add 6 codons for histidine. and then you got to create the reverse complementary sequence of that. you can do that manually.. or u may use some online softwares as well




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.