Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

how to find promoter sequence- my blat search doesnt seem to work?


  • Please log in to reply
3 replies to this topic

#1 shelleyanne1983

shelleyanne1983

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 12 September 2012 - 02:30 AM

hi all, i am trying to work out how to determine the promoter sequence for rat CYP2E gene, and have followed all the steps in the post how to find the promoter, through to the blat search, however when i try to get the alignment page, it looks nothing like the example BRCA1, i dont understand why? can anyone help?! There are no lines to suggest alignment? any help would be appreciated!

#2 paulcross

paulcross

    member

  • Active Members
  • Pip
  • 11 posts
1
Neutral

Posted 12 September 2012 - 06:23 AM

There are two different sequences of rat CYP2E gene, one is from BN/NHSDMCWI strain, another from SD strain. By default, the search result of Ensembl database is BN/NHSDMCWI sequence.

The full sequence of CYP2E1 with 20000 bp 5' UTR is :

http://asia.ensembl....es;_format=HTML


The transcibe start sequence is "GCCCCAGTGGCACCATGGCGGTTCTTGGCATCACC......"

Promoter region located ahead of that.

#3 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,160 posts
65
Excellent

Posted 12 September 2012 - 08:31 AM

Here you are. The first 600 is promoter sequence, the rest is first exon
>chromosome:RGSC3.4:1:200917921:200929519:1
TTGGTTAACTTTATCTGCTGCTACATTTTTGCCTCCATGGAATTTTCTGGCTGATTTGAC
ATGAAATGGGATCCAGATGCTGTTCTGCTCTCATTTTCCAAACAGGCCATTAGCGCTGTG
GTGCCAGATCAGAAGTTAAGTATTTGCAGCCTAGTGCCGTCTTTGGTCTGGAATGAGCGA
TAAATAGTTGGTAGTGCTTTGCAAAAACCTTTCCCCTACAAACAAACACGTGCAAACATG
ATCTGAATGCATGCCCACTATGCTGACCAGTGCCAGGGGGAGGACAGCTTCCCACCCCCA
GGACTGACCTATGAGTTGGTGAGGTATTCCTGCATGTGCTCACCAGCACTGACTGGTGCC
AGCAACCAGAGTATTGAGAAAGCCCAGCCTCATTCATGTCAGGTCAGTAGATGCAATTTC
TAAGAGGTAAAGGCTCCAAGGTTCAGCCTTTGAAATGATAGCCAACTGCAGCTAATAATA
AACCAGTACCTTAGGCCAAGGGAGAAGAGTGATTATTGGCTGATGAGCCACCCTCCTTCT
CAAGGATACATTATAAAATCTTTGTTTCTCTTCAGCAAATTCCTACAAGTTTACAGTGGA
GCCCCAGTGGCACCATGGCGGTTCTTGGCATCACCATTGCCTTGCTGGTGTGGGTGGCCA
CCCTCCTCGTCATATCCATCTGGAAGCAGATCTATAACAGTTGGAACCTGCCCCCAGGAC
CTTTCCCTCTTCCCATCCTTGGGAACATTTTTCAGCTGGATTTGAAGGATATCCCCAAGT
CTTTCACCAAG

The link to genome alignment: http://genome.ucsc.edu/cgi-bin/hgTracks?position=chr1:200917921-200918711&db=rn4&ss=../trash/hgSs/hgSs_genome_1424_b84c0.pslx+../trash/hgSs/hgSs_genome_1424_b84c0.fa&hgsid=297715623

#4 timeman

timeman

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 15 September 2012 - 11:18 AM

yes thats it!!! just try the ensembl!!! its the best way.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.