Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Help! No bands after BSP!


  • Please log in to reply
3 replies to this topic

#1 YYZDNA

YYZDNA

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 08 August 2012 - 01:41 AM

Hi.
I've been doing BSP recently. But I got a problem that I cannot get any bands after bisulphite specific PCR.
I used EZ DNA Methylation-Gold™ Kit to treat gDNA. The amount of treated gDNA is around 1.5 ug. I didn't digest gDNA before the treatment. The concentration of gDNA after treatment is around 50~80 ng/ul. And I always use 3ul to run PCR.

The specific primers has been used from a published paper. So I think they might work well.
the gDNA is down here:
CCAGGCAGTCCCCCAACTGTAAGGAAGACTCGTGTATGTATGTGCATATGTGCATTTCCCCAGGGAAAAACATCCACAGCTTCCATG
ACGAGAGGGGTCGTGACCCCTCCCCGCCAAAAGATTAAGGACCTGCGATCCTACAGACCGGAGCCCTGTTTGAAGTCTGCGTTGC
CCCTCACCTCAAGCTGGTCACTGTGTGAAGTTGGCCTAGAATCCCCCGGCCCCTGGGAGCTTGTTCCTCCGCCTGTAAAATGGGG
CTGCAGGGCCGTCCACGCGGCCACCGGAAGGACAAGGTGTTCAGGCCGCTAGGCCGCTCCCTGGCAAGCGATTCCCACTCGCAG
CGCGGCCTCGACCCTCGCCCAAGACGCGCCCTCCGCGCCCCCACCCCCTCCAGGCCCTGGCCAGTCCACCTCCCGCTTGGGGCG
GCAATTTGTCTCCTTTTGAACCCCCCGCCCCCGACGGGTTTCCCCCTTTGATTCGCGGCCCGGAGGCTTCCCCCCGCTTTGAAATG
CAAACCCGCCTCGGCTGGGGCCGCGGGCGGCCCGGAGCTATAAAAGGCCTGGGTGGGGCGGGCGCGGCGGCAGGACAGCCGAG
TTCAGGTGAGCGGTTGCTCGTCGTCGGGGCGGCCGGCAGCGGCGGCTCCAGGGCCCAGCATGCGCGGGGGACCCCGCGGCCACC

the methylated target sequence:
TTAGGTAGTTTTTTAATTGTAAGGAAGATTCGTGTATGTATGTGTATATGTGTATTTTTTTAGGGAAAAATATTTATAGTTTTTATGACGA
GAGGGGTCGTGATTTTTTTTCGTTAAAAGATTAAGGATTTGCGATTTTATAGATCGGAGTTTTGTTTGAAGTTTGCGTTGTTTTTTATT
TTAAGTTGGTTATTGTGTGAAGTTGGTTTAGAATTTTTCGGTTTTTGGGAGTTTGTTTTTTCGTTTGTAAAATGGGGTTGTAGGGTCG
TTTACGCGGTTATCGGAAGGATAAGGTGTTTAGGTCGTTAGGTCGTTTTTTGGTAAGCGATTTTTATTCGTAGCGCGGTTTCGATTTTC
GTTTAAGACGCGTTTTTCGCGTTTTTATTTTTTTTAGGTTTTGGTTAGTTTATTTTTCGTTTGGGGCGGTAATTTGTTTTTTTTTGAATT
TTTCGTTTTCGACGGGTTTTTTTTTTTGATTCGCGGTTCGGAGGTTTTTTTTCGTTTTGAAATGTAAATTCGTTTCGGTTGGGGTCGC
GGGCGGTTCGGAGTTATAAAAGGTTTGGGTGGGGCGGGCGCGGCGGTAGGATAGTCGAGTTTAGGTGAGCGGTTGTTCGTCGTCG
GGGCGGTCGGTAGCGGCGGTTTTAGGGTTTAGTATGCGCGGGGGATTTCGCGGT

the primers are :
sense TTATTTTTTTTAGGTTTTGGTTAGTT
antisense CCACCCAAACCTTTTATAACTC
I used hot start Taq to run PCR and the annealing temp is 55.
I also tried a Touchup PCR with the annealing temp changing from 50 to 60, then 55.

but I cannot get any band still. could someone help me?

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 11 August 2012 - 11:43 AM

Everything looks fine to me. How many cycles do you run your PCR? You can run 40 cycles, and then take 1-2 ul of the first pcr product as template to run another PCR for 25-30 cycles using the same primers.

#3 vilperte

vilperte

    member

  • Active Members
  • Pip
  • 19 posts
0
Neutral

Posted 08 February 2013 - 03:53 AM

I'm using the PfuTurbo Cx Hotsart DNA Polymerase, it works very well!

You can try to decrease the extension temperature to 65C and increase the time for 2 minutes. It really helped me :)

#4 Alberto Villalobos

Alberto Villalobos

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 11 February 2014 - 11:43 AM

Hi, I have been having troubles with my MSPCR for a long time . I tried to establish the best temperature for both Methylated and Unmethylated PCR products...

I used a cell line that is already reported that should be positive for both events (SNU423 hepatocellular carcinoma, which has one allele methylated and the other unmethylated).

After the genomic DNA extraction I perform the Bisulfite treatment and used this treated DNA for MSPCR using primers specifics for Meth and Unmeth. 

I have bands in the methylated one but I dont obtain any bands in the unmethylated which is not in according to the literature... 

What could be happening ??????






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.