Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

complicated RT-PCR issues

RT-PCR primers PCR troubleshooting

  • Please log in to reply
4 replies to this topic

#1 medecinfrancais

medecinfrancais

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 26 July 2012 - 07:36 AM

Hi all,

I am working on verifying RNAi knockdown of a very large gene (~18,000 nts). The gene is comprised of many repetitive elements, and I have used up almost the entirety of a unique region with my RNAi construct. Despite best efforts to locate a new, entirely unique sequence for my primers, I have been unsuccessful. I have a few questions to try and set up my next attempt:

1) Could I use the primers I originally used from the RNAi construct (to amplify my insert) in the RT-PCR, or will I still see amplification due to my insert?

2) I am able to find partially unique primers for both the 5' and 3' (they are ~50% unique; the 10 interior bases match, 10 exterior bases do not). From the 10th base on the 5' end to the 10th from last base on the 3' end, the transcript which would be amplified matches between this gene and another. Is non-specific amplification likely (so I would see a 220 bp and a 240 bp fragment, if I could even tell a difference between the two)?

3) In the above scenario, would there also be a possibility of hybridization, leading to non-specific amplification (in effect a new primer being created from overhangs on the 220/240 bp frags)?

Thanks,
medecinfrancais

#2 doxorubicin

doxorubicin

    Veteran

  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 147 posts
7
Neutral

Posted 26 July 2012 - 01:22 PM

It is strange you can't find primers for your gene.  Did you try Primer-Blast?

#3 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,032 posts
46
Excellent

Posted 26 July 2012 - 06:12 PM

Yes, that is strange you could not design RT-PCR primers on your genes. I don't think that the entire sequence is repetitive, probably there are psudogeenes?

The primers used for construct shRNA are not good for PCR, since the oligos are just two complementary ones to form a ds-oligo.

Can you post the gene name and the organism here?

#4 medecinfrancais

medecinfrancais

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 27 July 2012 - 03:08 AM

View Postpcrman, on 26 July 2012 - 06:12 PM, said:

Yes, that is strange you could not design RT-PCR primers on your genes. I don't think that the entire sequence is repetitive, probably there are psudogeenes?

The primers used for construct shRNA are not good for PCR, since the oligos are just two complementary ones to form a ds-oligo.

Can you post the gene name and the organism here?

You would be surprised! The 5' side is conserved with one gene in the same family, and the 3' side is composed entirely of repeats, which are shared with another gene of the same family.

The organism is T. brucei in procyclic form (927/GUTat10.1), and the gene can be found at TriTrypDB here (nucleotide and amino acid sequences near bottom of the page): http://tritrypdb.org...ct_id=TriTrypDB

The dsRNA-generating insert was located between bases 3356-3759 of the gene.

I had designed two different primer sets for RT-PCR. They amplify between bases 1115-1345 and bases 3119-4608, respectively, and I used PrimerBLAST alongside other tools to generate these. Both sets show undesired amplicons at the wrong size in addition to amplicons at the correct size (Tm for the PCR = 60 C, and manufacturer-specified primer Tms are around 58-59 C). There is no reduction in intensity for the right-sized amplicons going through 10 days of RNAi induction.

Thank you all for your help.

#5 doxorubicin

doxorubicin

    Veteran

  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 147 posts
7
Neutral

Posted 27 July 2012 - 04:01 AM

Looking at the genomic sequence (NT_165288.1) and the Provisional mRNA sequence (XM_823109.1) it would appear that there are no introns (Is this truly the case?). When I run Primer-Blast including the RefSeq specificity check, it proposes a number of specific primers, including:


Products on intended target
>XM_823109.1 Trypanosoma brucei brucei strain 927/4 GUTat10.1 calpain-like protein (Tb11.57.0008) partial mRNA
Primer Pair 1:

product length = 284
Forward primer  1     TCGACTTGCTCTGCCGAAAT  20
Template        1371  ....................  1390

Reverse primer  1     TACGAGGAAGGCGATGCAAG  20
Template        1654  ....................  1635


Primer pair 2:
product length = 292
Forward primer  1     TTAGTCGACTTGCTCTGCCG  20
Template        1367  ....................  1386

Reverse primer  1     CCACTACGAGGAAGGCGATG  20
Template        1658  ....................  1639

Primer pair 3:
product length = 95
Forward primer  1     GGGAGCGGAGAGTGCATTTA  20
Template        1299  ....................  1318

Reverse primer  1     GCAATTTCGGCAGAGCAAGT  20
Template        1393  ....................  1374

Do you have a reason to think these won't work?





Also tagged with one or more of these keywords: RT-PCR, primers, PCR, troubleshooting

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.