Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

* * * * * 2 votes

Did my EcoRI restriction digestion work? picture included!

ecori restriction digestion

  • Please log in to reply
49 replies to this topic

#1 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 27 June 2012 - 06:41 AM

Hello Everyone,

I digested using EcoRI to analyze my transformants. The vector, pCR 4Blunt-TOPO, is 3956bp (an online image shows where EcoRI cuts). My insert is approx. 460-490bp. The control insert is 800bp. I ran a gel of my digestion and its attached.
The organization of the gel is
the first 10 from the left are TOPO+my insert digestion
the second following 10 are TOPO+control insert digestion
06.26.2012 ECORI digestion of TOPO 48 FB and TC2.stp.jpg

I want to know if the digestion worked for some atleast.
Thanks all,
Fluffy:)

Edited by Fluffy, 27 June 2012 - 06:43 AM.


#2 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 27 June 2012 - 10:17 AM

Hi,
the marker is not described so I cannot say anything about the size of your fragments. Also the Topo-Fragment is not well detected...I can, at least guess, where the band could be.
By the way, it is also helpful to load the undigested Plasmid to compare the sizes.

I would say the digestion worked but only because the first then lanes look similar and the bands are located in the 400 bp area of a general agarose gel

Edited by Papaver, 27 June 2012 - 10:20 AM.


#3 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 27 June 2012 - 10:53 AM

View PostPapaver, on 27 June 2012 - 10:17 AM, said:

Hi,
the marker is not described so I cannot say anything about the size of your fragments. Also the Topo-Fragment is not well detected...I can, at least guess, where the band could be.
By the way, it is also helpful to load the undigested Plasmid to compare the sizes.

I would say the digestion worked but only because the first then lanes look similar and the bands are located in the 400 bp area of a general agarose gel

I am not sure but by marker do you mean the ladder? If so, it is a 1kb ladder.

You are right I shoud have loaded the undigested vector as well

Thanks

#4 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 27 June 2012 - 10:31 PM

Yes, I've meant the ladder :)
The 1 kb ladder of which company? They always differ a little bit...

#5 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 29 June 2012 - 12:31 PM

View PostPapaver, on 27 June 2012 - 10:31 PM, said:

Yes, I've meant the ladder Posted Image
The 1 kb ladder of which company? They always differ a little bit...

Hi
sorry for my late reply. My 1kb ladder is from invitrogen I believe. I did another EcoRI digestion again today. I have attached the file.
06.29.2012 EcoRI digestion+analyzing positive transformants.jpg
I used more plasmid DNA this time, 4uL in a 10uL (my plasmid concentration is approx. 100ng/uL). I used 2uL buffer, 1uL EcoR1 enzyme. I am not sure why I have multiple bands.
The organization of the gel is as follows,
The first three from the left are undigested plasmid (control)
the next following 10 are digested.
What do you think?
Thanks!

#6 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 30 June 2012 - 04:39 AM

Hi...so, basically, I would say your cloning worked well. I'm wondering why the third control plasmid is a bit smaller than first and second. Are these Plasmid from three different clones? And how about the digested Plasmids...does the digested Plasmid one belongs to undigested (control) one, and so on?

Every digested Plasmid shows a fragment of ~ 500 kb which fits to your information of the first post.
Considering multiple bands: In general I would say that all except No. 3 (with two bands) are not completely digested since I don not exactly know if control three and digested three are the same. On the other side the fragment of No. 3 is a bit smaller than the others.

So I would take No 3 and one of the others and sequence them to make sure everything is right.

Now some last words to your restriction protocol...
400 ng are sometimes not enough...the smaller the fragment the more difficult it is to see the band in the gel. I once had to deal with that...I couldn't see my insert (it was ~ 300 kb) and then I ran a PCR and I got it. Since then I always try to use at least 500 ng, better 600. Usually the companies supply a 10x buffer so 2 µl of buffer would be too much in a 10 µl reaction and 1 µl enzyme is also too much. It can cause unspecific cuts, especially with EcoRI.

A good set up would be (in my opinion) for your DNA:
6 µl DNA (à 100 ng/µl)
2 µl EcoRI-buffer (10x)
0.5 µl EcoRI
11.5 µl water
--> 37°C for 1-2 h (or less if it is a fast digest enzyme)
Then load as much as possible onto the gel.

Edited by Papaver, 30 June 2012 - 04:40 AM.


#7 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 30 June 2012 - 04:36 PM

View PostPapaver, on 30 June 2012 - 04:39 AM, said:

Hi...so, basically, I would say your cloning worked well. I'm wondering why the third control plasmid is a bit smaller than first and second. Are these Plasmid from three different clones? And how about the digested Plasmids...does the digested Plasmid one belongs to undigested (control) one, and so on?

Every digested Plasmid shows a fragment of ~ 500 kb which fits to your information of the first post.
Considering multiple bands: In general I would say that all except No. 3 (with two bands) are not completely digested since I don not exactly know if control three and digested three are the same. On the other side the fragment of No. 3 is a bit smaller than the others.

So I would take No 3 and one of the others and sequence them to make sure everything is right.

Now some last words to your restriction protocol...
400 ng are sometimes not enough...the smaller the fragment the more difficult it is to see the band in the gel. I once had to deal with that...I couldn't see my insert (it was ~ 300 kb) and then I ran a PCR and I got it. Since then I always try to use at least 500 ng, better 600. Usually the companies supply a 10x buffer so 2 µl of buffer would be too much in a 10 µl reaction and 1 µl enzyme is also too much. It can cause unspecific cuts, especially with EcoRI.

A good set up would be (in my opinion) for your DNA:
6 µl DNA (à 100 ng/µl)
2 µl EcoRI-buffer (10x)
0.5 µl EcoRI
11.5 µl water
--> 37°C for 1-2 h (or less if it is a fast digest enzyme)
Then load as much as possible onto the gel.

Yes the control plasmid are from different clones. The first corresponds to the No.7 digested plasmid, the second one corresponds to No.8 digested plasmid, and finally the third undigested control plasmid is the No.13 digested plasmid.
I also thought I should point out that to you, I used this website http://www.restrictionmapper.org/ that allows you to paste the sequence of your construct (including the insert), and based on the website I got it shows there are 3 cut positions. This is worrying.

#8 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 01 July 2012 - 07:42 AM

This would mean that your insert has an EcoRI site (Topo has two). Why don't you use other enzymes which do not cut your insert to confirm the correct cloning or run a PCR and see if you get the expected size. I would recommend NEBcutter (http://tools.neb.com/NEBcutter2/) to analyse your sequences. It shows all one-cutters but you can perform custom digest or let show all two cutters or no cutters...

#9 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 01 July 2012 - 05:29 PM

View PostPapaver, on 01 July 2012 - 07:42 AM, said:

This would mean that your insert has an EcoRI site (Topo has two). Why don't you use other enzymes which do not cut your insert to confirm the correct cloning or run a PCR and see if you get the expected size. I would recommend NEBcutter (http://tools.neb.com/NEBcutter2/) to analyse your sequences. It shows all one-cutters but you can perform custom digest or let show all two cutters or no cutters...

Thanks youve been really patient.
One more thing please, I used your website and I put the sequence of my insert to see what enzymes cut it. Now, do I put the sequence I used to design my primers, or the complementary of it? If I put the one used to design my primers then there is no cutting site for EcoRI, but the complementary one has an EcoRI site. This confuses me. Earlier in one of my posts I mentioned that my insert might have an EcoRI cutting site according to the site I used, but to let you know I used the complementary sequence. So do you think I should use the sequence used to design my primers (the one you find on genbank) and not its complementary?
Thanks!!

#10 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 01 July 2012 - 10:19 PM

I'm not quite sure what you mean with complementary sequence but it counts the sequence you get with the PCR. It is, of course, possible that your sequence differs from that of Genbank in case it's the same gene from a different species. Only one change in sequence could lead to an appearence (or disappearence) of restrictions sites.

#11 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,805 posts
130
Excellent

Posted 02 July 2012 - 05:26 AM

It should not matter if you put in the sequence or its reverse complement.  Probably you are not doing the reverse complement correctly if you get a different number of cut sites when switching from one to the other.

#12 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 02 July 2012 - 09:25 AM

View Postphage434, on 02 July 2012 - 05:26 AM, said:

It should not matter if you put in the sequence or its reverse complement.  Probably you are not doing the reverse complement correctly if you get a different number of cut sites when switching from one to the other.

Hello Phage,
Here is my cDNA sequence
atggcgtcgaagaggatattgaaggagctcaaggatctgcagaaggatccccccacatcatgcagtgctggtccagtggcagaggatatgttccattggcaagcaacaatcatggggcctaccgatagcccttatgctggaggtgtatttttggtttcaattcatttccctccagattatccttttaagcctccaaaggttgccttcagaactaaggttttccatcccaacatcaacagcaatggaagtatttgtctggatattcttaaggagcagtggagtccagcattaaccatatccaaggtcctgctgtccatctgctctctgttgacagacccaaacccagatgatcctcttgtacctgaaattgctcacatgtacaagactgacagggccaaatacgaaaccactgctcgtagctggactcagaaatatgcaatgggatga
Here is its complement
TACCGCAGCTTCTCCTATAACTTCCTCGAGTTCCTAGACGTCTTCCTAGGGGGGTGTAGTACGTCACGACCAGGTCACCGTCTCCTATACAAGGTAACCGTTCGTTGTTAGTACCCCGGATGGCTATCGGGAATACGACCTCCACATAAAAACCAAAGTTAAGTAAAGGGAGGTCTAATAGGAAAATTCGGAGGTTTCCAACGGAAGTCTTGATTCCAAAAGGTAGGGTTGTAGTTGTCGTTACCTTCATAAACAGACCTATAAGAATTCCTCGTCACCTCAGGTCGTAATTGGTATAGGTTCCAGGACGACAGGTAGACGAGAGACAACTGTCTGGGTTTGGGTCTACTAGGAGAACATGGACTTTAACGAGTGTACATGTTCTGACTGTCCCGGTTTATGCTTTGGTGACGAGCATCGACCTGAGTCTTTATACGTTACCCTACT

If you enter each one in the following site (http://tools.neb.com/NEBcutter2/) you will realize that the complement has an EcoRI site while the cDNA sequence doesn't.

But I guess to know if my insert has an EcoRI cutting site, I would have to look at the cDNA sequence.
Thanks,
Yasamin


#13 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 02 July 2012 - 11:01 AM

View PostFluffy, on 02 July 2012 - 09:25 AM, said:

But I guess to know if my insert has an EcoRI cutting site, I would have to look at the cDNA sequence.

Yes! Posted Image Or, you look at the reverse complement...your complement sequence is from 3' to 5' and the EcoRI site is there if you read from 3' to 5' which is not correct and leads to misunderstandings Posted Image

Altogether...your insert has no EcoRI site...that's why your fragment in the digestion is ~ 500 kb and not smaller...it would be if there was a EcoRI site.

Good luck for your further experiments.

Edited by Papaver, 02 July 2012 - 11:04 AM.


#14 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,805 posts
130
Excellent

Posted 02 July 2012 - 11:28 AM

Just to be certain you've understood:  You have taken the complement, not the reverse complement of the sequence.  The complement will have different sites (and is unrelated to the original sequence).  Only the reverse complement makes sense from a biological perspective, and it will have the identical restriction sites as the original sequence.  You should review the anti-parallel structure of double stranded DNA to fully internalize this.

#15 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 02 July 2012 - 02:51 PM

I am sorry I did not think you meant reverse complement. Thanks to you Papaver and Phage for the information. Phage, your last comment makes total sense and helps me understand things better. Papaver, since that is the case, I will try your protocol for digestion mentioned in earlier posts and let you know what happens.
Thanks again





Also tagged with one or more of these keywords: ecori, restriction, digestion

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.