10 replies to this topic

[Ambinlab]

Dear All,

I am trying to clone a gene with kozak sequence before ATG and HA tag at the end. I designed two long primers with restriction sites and kozak and HA sequence:
Fwdprimer: tm:106, length:33
Revprimer: tm:148 length:52
However the part of the primers that are annealing to the template are short (12 for each) and the tm is around 33.
I tried PCR with annealing temperature 32. I was not able to get the right size pcr product. I got only two large non specific bands. I am using pfx.

Any ideas are highly appreciated. I need to finish this cloning soon.

[leelee]

That annealing temp is way too low and I'm not surprised you are getting non specific binding.

The 12bp regions of your primers anneal to your template in the original round of PCR- but remember in each subsequent cycle, the whole primer will anneal to the amplicon (which now has your whole primer sequence at either end).

Your best bet is to perform a gradient PCR (or two) over a range of temperatures. I would suggest starting with something in the vicinity of maybe 45-50C and working right up to about 60C.

[phage434]

I don't think these primers will ever work.  Normal PCRs use primers that bind to 18-24 bp regions of the template.  I've never had a primer that short work.  Also, I've never seen a PCR with annealing less than about 48 C work.

[Ambinlab]

Hi All,

I redesigned the primers with tm ~55 for the annealing part. Well, You were right! It worked!!! my PCR worked...

However, the problem is when I digested and purified the PCR product and ligated with my digested and purified vector, I got the insert WITHOUT ANY TAG or KOZAK?!!!!!!!!!!!!!

I really have no idea why this is happening. I loaded the PCR product on a gel and it seems that it is amplified.

Any clues? This cloning drives me crazy

[phage434]

Perhaps you have mistakenly inserted a RE cut site between your insert and the kozak/tag portion of your PCR product.  Can't help without knowing more, such as primer sequences, REs used, exact protocols.

[Ambinlab]

Thanks.The following primers used:

Fwd:  ATAT GCGGCCGC (NOTI) GCCGCCACC (Kozak) ATGXXXXXXXXXXXXXX (Tm annealing part: 52)
Rev:  tgaactcgag (XHOI) TTAAGCGTAATCTGGAACATCGTATGGGTA(HA tag) XXXXXXXXXXXXXX (Tm annealing part: 52)

I amplified using PCR. Ran on a gel, looked like I have the right insert. The template used was plasmid containing my gene of interest. I digested and purified the insert and did the ligation. However, my sequencing results showed that I have my insert there but with no tag/kozak. (i.e before ATG i had my RE site)

Thanks

[phage434]

It's hard to speculate on what exactly is happening, but the very high GC region of your forward primer could be a problem.  The primer forms excellent hairpins and self-dimers with the stem/loop GCGGC cgc GCCGC.  Can you change your RE from NotI to a different (lower GC) enzyme?  You might want to get into the habit of analyzing your primers with a tool such as the oligo analyzer at http://idtdna.com.

[Ambinlab]

Thanks for the answer. However, it may not be because of Kozak sequence because I could not get the tag as well.

I am just wondering how I can seperate DNAs with the difference of ~40bp? If I can do it I may be able to get and purify the insert with TAG and Kozak?

[phage434]

Perhaps you are transforming with plasmid DNA that came from your PCR template rather than from your PCR amplified DNA.  Are the primers you use also found on the original template DNA for your gene?  If so, then I'd suggest that template DNA is purified along with your PCR product and is transforming cells, rather than your ligation product.  You can reduce this by treating your PCR product with DpnI which selectively cuts template DNA rather than amplified DNA, and by using very small amounts of template.  But what this really means is that you have not successfully ligated product - probably because of problems cutting at the NotI site.  Make doubly sure you purify your PCR product before RE digestion.

[Ambinlab]

Many Thanks

That is actually a good idea. I checked my template DNA. It did not have the same sites. I used gradient PCR to find a good T annealing. Then I purified the PCR product (may be i should gel purify to get rid of template DNA?) and ligated. I got ~ 20 colonies on my ligated plate and ~ 8 colonies on the control plate (only digested vector with no insert)
I digested 6 colonies all of which released the insert. And I gave three for sequencing.
Ideas?

[Adrian K]

Ambinlab, on 29 June 2012 - 10:23 PM, said:

Thanks.The following primers used:

Fwd:  ATAT GCGGCCGC (NOTI) GCCGCCACC (Kozak) ATGXXXXXXXXXXXXXX (Tm annealing part: 52)
Rev:  tgaactcgag (XHOI) TTAAGCGTAATCTGGAACATCGTATGGGTA(HA tag) XXXXXXXXXXXXXX (Tm annealing part: 52)

I amplified using PCR. Ran on a gel, looked like I have the right insert. The template used was plasmid containing my gene of interest. I digested and purified the insert and did the ligation. However, my sequencing results showed that I have my insert there but with no tag/kozak. (i.e before ATG i had my RE site)

Thanks

Just curious, how long is your expected product size / how long the fragment you cloned in to your vector?