I would like to make some siRNAs based on published shRNA sequences. The paper indicates that "Two shRNA expression cassettes were generated that targeted P56 mRNA at nt 12–41 (shRNA1) and nt 1443–1472 (shRNA2)"
12-41: gctgctgtttagctcccttatataacactg
1443-1472: gaaaggcattagatctggaaagcttgagcc
Is it obvious which 19-21bp sequence would make effective siRNA based on these 30bp sequences?
0
No replies to this topic
