Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!

siRNA based on published shRNA

sirna design

  • Please log in to reply
No replies to this topic

#1 doxorubicin

  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 192 posts

Posted 06 June 2012 - 11:56 PM

I would like to make some siRNAs based on published shRNA sequences. The paper indicates that "Two shRNA expression cassettes were generated that targeted P56 mRNA at nt 12–41 (shRNA1) and nt 1443–1472 (shRNA2)"
12-41: gctgctgtttagctcccttatataacactg
1443-1472: gaaaggcattagatctggaaagcttgagcc
Is it obvious which 19-21bp sequence would make effective siRNA based on these 30bp sequences?

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.