Hi all,
I'm looking for some help with justifying an experiment that I've already done that involves using PAMAM dendrimers to deliver small RNAs into SKOV-3 cells.
It should've been a very straightforward set of experiments; use RT-PCR to first establish the relative levels of expression of a microRNA important in ovarian cancer between adherent SKOV-3 cells and SkSp cells grown as free-floating spheroids. The SKOV-3 monolayer cells' microRNA levels would be the control. After establishing this, the dendrimers could be used to deliver microRNA inhibitors or mimics to re-establish normal levels of microRNA expression.
The crux of my research project was to demonstrate that dendrimers were efficient devlivery vehicles for small RNAs and to contrast their efficiencies at different concentrations, etc.
However, the RT-PCR turned out to be a real challenge, and by the time I was able to figure out a protocol that gave me consistent results with untreated cells it was really late in the day to start ordering mimics and inhibitors and things.
What I did instead was to try and get creative with what I had. A labmate had, for some reason, ordered various oligodeoxynucleotide primers of the same sequence as various microRNA, with sequences obtained from mirBase. For instance, the hsa-let-7a-5p primer had the sequence of: tgaggtagtaggttgtatagtt, which is basically the sequence of the mature miRNA but with deoxynucleotides. I refer to them as "sense-ODNs".
I reasoned that such primers would be tantamount to the same mature miRNA sequence if being detected by RT primers (which would also be ODNs). Hence, if I were to transfect these primers with sequences equivalent to mature miRNAs, and then perform RT-PCR with primers to detect the sequence of the mature miRNA, the additional sense-ODNs that were transfected should also be detected.
I used let-7a, 7b and 7c, which are downregulated in SkSp cells, and found that the levels of nucleic acids with sequences equivalent to the mature miRNA sequence detected by RT-PCR were found to have inceased when compared to the controls.
Now, I do realise that this is fundamentally not the same as actually affecting the function of the miRNA and affect changes in the progress of the cancers. The downstream effects of re-establishing miRNA levels would definitely not be seen. However, as I have mentioned, the thrust of the project is meant to be to highlight the ability of dendrimers as delivery vehicles; hence, I reason that the above experiment would be sufficient as a proof-of-principle that the dendrimers would be able to deliver the material for miRNA transfections successfully, especially given that many of the inhibitors and mimics are single-stranded, as are these sense-ODNs. I, like most, have had no problems transfecting ds-siRNA into cells.
What I would like your opinion on is the status of this "creative" substitution as a proof-of-principle about potential future uses for dendrimers with miRNA, and how I could best go about justifying this. I know there are differences with how dendrimers bind to single-stranded and double-stranded molecules which could play a part in the transfections, for instance.
I would also deeply appreciate any references to research that could be provided, since I have found only two papers that use miRNA and dendrimers.
Thanks, and I look forward to your critiques.
--
Shashwati Kala
Substituting miRNA with ODNs for testing efficiency of dendrimers...?
Started by shashwati, May 22 2012 01:51 PM
microRNA RT-PCR dendrimers Dendrimers
4 replies to this topic
#1
Posted 22 May 2012 - 01:51 PM
#2
Posted 22 May 2012 - 03:01 PM
If the DNA changed the signal from the cells, that suggests it entered the cells to do so.
I'd worry about two possibilities:
1. the DNA didn't wash off well and you are detecting extracellular DNA by RT-PCR. I think this is fairly unlikely, but might be difficult to disprove.
2. the PAMAM might be causing the difference in gene expression. You can establish that with a vehicle-only control, which you likely already did but did not write about here.
I'd worry about two possibilities:
1. the DNA didn't wash off well and you are detecting extracellular DNA by RT-PCR. I think this is fairly unlikely, but might be difficult to disprove.
2. the PAMAM might be causing the difference in gene expression. You can establish that with a vehicle-only control, which you likely already did but did not write about here.
Jon D. Moulton
Gene Tools, LLC
www.gene-tools.com
Gene Tools, LLC
www.gene-tools.com
#3
Posted 22 May 2012 - 03:08 PM
First off, thanks a lot for your reply.
The transfection conditions were:
i. Complexation of dendrimers-ODNs for 30 mins at RT in serum- and antibiotic-free medium.
ii. 24 hours of transfection.
iii. Wash with PBS and lysing with Trizol.
Would the extracellular DNA still be a major concern with this method?
And you're right - in previous experiments I'd established that using dendrimer-only transfection medium, no significant changes were seen in gene expression (or at least, the genes I was focusing on here).
In any case, the points you've mentioned allow me to criticise my own effort better, which makes for a better presentation.
Thanks again,
--
Shashwati Kala
The transfection conditions were:
i. Complexation of dendrimers-ODNs for 30 mins at RT in serum- and antibiotic-free medium.
ii. 24 hours of transfection.
iii. Wash with PBS and lysing with Trizol.
Would the extracellular DNA still be a major concern with this method?
And you're right - in previous experiments I'd established that using dendrimer-only transfection medium, no significant changes were seen in gene expression (or at least, the genes I was focusing on here).
In any case, the points you've mentioned allow me to criticise my own effort better, which makes for a better presentation.
Thanks again,
--
Shashwati Kala
#4
Posted 22 May 2012 - 03:30 PM
shashwati, on 22 May 2012 - 03:08 PM, said:
The transfection conditions were:
i. Complexation of dendrimers-ODNs for 30 mins at RT in serum- and antibiotic-free medium.
ii. 24 hours of transfection.
iii. Wash with PBS and lysing with Trizol.
Would the extracellular DNA still be a major concern with this method?
i. Complexation of dendrimers-ODNs for 30 mins at RT in serum- and antibiotic-free medium.
ii. 24 hours of transfection.
iii. Wash with PBS and lysing with Trizol.
Would the extracellular DNA still be a major concern with this method?
I don't know. If you can come up with a good control strategy to eliminate the possibility of extracellular ODNs contaminating your sample, you will increase confidence in your cytosolic delivery assay.
Jon D. Moulton
Gene Tools, LLC
www.gene-tools.com
Gene Tools, LLC
www.gene-tools.com
#5
Posted 02 June 2012 - 09:53 AM
Cationic polymers are not the best option for small ODNs. The complex formed for short nucleic acids may not be stable enough. Try lipid-based transfection reagent, or add some carrier plasmid DNA to OND or siRNA to improve the stability of the resulted complex.














