Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Site-directed mutagenesis

mutagenesis DpnI Pfu

  • Please log in to reply
14 replies to this topic

#1 Alisa

Alisa

    member

  • Active Members
  • Pip
  • 6 posts
1
Neutral

Posted 13 May 2012 - 07:49 PM

Hi, I've done mutagenesis for 3 month, but until now all of my colonies are wild type. My vector is pDEST26 (7.3kb) and target gene is 3kb ,so total gene is about 12kb. I've try lots of conditions:

1. Used

Stragene QuikChange II site directed mutagenesis Kit



10x reation buf.      5ul
DNA template      50ng
f-primer                  1ul
r-primer                  1ul
dntp                        1ul
ddH2O                  36ul
pfu                          1ul
TOTAL                 50ul

95

℃-->1 min

95℃-->30sec
55℃-->1min
68℃-->12min  (30cycles)

68℃-->5min

DpnI digest for 1hr, add 4ul DpnI digested product to 50 ul competent cell(DH5a)

2ml SOC incubate 6hr

incubate on plate(amp+)

@this condition I have lots of colonies but they are not mutant!

2. Used

Stragene QuikChange II site directed mutagenesis Kit



I asked Stragene. They suggest that I can raise anneal tem. to Tm-3

℃.

So I change my tem to 62, again I can't get any mutatant!

3. Use pfu from fermantas  and change primer (design from

Stragene:  

QuikChange Primer Design)


I can't get any mutatant again!

I am no idea now!!

One of my friends said that I  should use

Stragene's pfu (for large vectors), it's that true? But it's so expensive!!


Anyone who has better ideas please tell me!
Thank you!

#2 kaveh

kaveh

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 31 posts
1
Neutral

Posted 13 May 2012 - 08:45 PM

I needed to do a SDM on 12K vector a while back. I didn't have the Stragene kit and decided to give our high fidelity polymerase (AccuPrime Pfu, Invitrogen) a try. I designed the primers with the Strategen web tool and ordered the primers. Since the primers were long, I asked the company to purify them on PAGE (this takes a longer time and more money, so it's not going to be a 10$ per pair primer). Then I borrowed the dpnI from the neighbors and that did it! all my colonies were mutant. Here is my thoughts:

1) Are you sure about your primer design? They have to be overlapping and long.
2) Did you purify the primers?
3) Do you give the polymerase enough time? (12 minutes should be fine, but I would give it a little longer)
4) I might be wrong, but a longer dpnI treatment might help to eliminate more of the original plasmid.
5) How do you check for the mutation? sequencing?

#3 Alisa

Alisa

    member

  • Active Members
  • Pip
  • 6 posts
1
Neutral

Posted 13 May 2012 - 09:27 PM

View Postkaveh, on 13 May 2012 - 08:45 PM, said:

I needed to do a SDM on 12K vector a while back. I didn't have the Stragene kit and decided to give our high fidelity polymerase (AccuPrime Pfu, Invitrogen) a try. I designed the primers with the Strategen web tool and ordered the primers. Since the primers were long, I asked the company to purify them on PAGE (this takes a longer time and more money, so it's not going to be a 10$ per pair primer). Then I borrowed the dpnI from the neighbors and that did it! all my colonies were mutant. Here is my thoughts:

1) Are you sure about your primer design? They have to be overlapping and long.
2) Did you purify the primers?
3) Do you give the polymerase enough time? (12 minutes should be fine, but I would give it a little longer)
4) I might be wrong, but a longer dpnI treatment might help to eliminate more of the original plasmid.
5) How do you check for the mutation? sequencing?
Hi
(1)My primer design is from Strategen web tool like you, and my primer is 35bp.
(2) I didn't ask company to purify my primer.
(3) I sent my colonies to sequencing
I'll try longer  extension time and DpnI treatment.
Thank you for your advises!

#4 GNANA

GNANA

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 193 posts
6
Neutral

Posted 14 May 2012 - 01:05 AM

i have done lot of SDMs and i never had failure untill now...your protocol looks ok, but your PCR cycle shdnt be 30.  may be 15 shd be more than enough.  after dpn digestion do a gel purification and transform.  my usual primer design tool is Primer X.....i use Accuprime pfx from invitrogen.....

good luck...
I would prefer being perfectionist rather than a passionist in Research.

I always had an alternate hypothesis....

#5 Alisa

Alisa

    member

  • Active Members
  • Pip
  • 6 posts
1
Neutral

Posted 14 May 2012 - 11:52 PM

View PostGNANA, on 14 May 2012 - 01:05 AM, said:

i have done lot of SDMs and i never had failure untill now...your protocol looks ok, but your PCR cycle shdnt be 30.  may be 15 shd be more than enough.  after dpn digestion do a gel purification and transform.  my usual primer design tool is Primer X.....i use Accuprime pfx from invitrogen.....

good luck...
Hello Veteran:
I've done 18cycles before, but I got no colonies.

Thanks for advises!

#6 GNANA

GNANA

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 193 posts
6
Neutral

Posted 15 May 2012 - 12:33 AM

Did you check on gel after PCR done with 18 cycles??. bcoz no colonies might also be due to lack of adequate competency in your competent cells.  anyways doing 30 cycles on 12 kb vector is not recommended as your enzyme availability and fidelity for the entire 30 cycles is a matter of concern. even i you get positive SDMs there is also possibility of other mutations with your 30 cycle PCR. so i would suggest you to standardize your PCR to get a band in 15 cycles or around.
I would prefer being perfectionist rather than a passionist in Research.

I always had an alternate hypothesis....

#7 Alisa

Alisa

    member

  • Active Members
  • Pip
  • 6 posts
1
Neutral

Posted 15 May 2012 - 09:30 PM

View PostGNANA, on 15 May 2012 - 12:33 AM, said:

Did you check on gel after PCR done with 18 cycles??. bcoz no colonies might also be due to lack of adequate competency in your competent cells.  anyways doing 30 cycles on 12 kb vector is not recommended as your enzyme availability and fidelity for the entire 30 cycles is a matter of concern. even i you get positive SDMs there is also possibility of other mutations with your 30 cycle PCR. so i would suggest you to standardize your PCR to get a band in 15 cycles or around.
Hi

I can't see band on my PCR gel, but

Stragene's guideline said that maybe can't visable. Is that true?

I also try to send plasmid( not mutation) to competent cells, and I got lots of colonies. Seems that my competent cells have no problem.



#8 GNANA

GNANA

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 193 posts
6
Neutral

Posted 16 May 2012 - 12:22 AM

Reg your competent cells taking up the plasmid doesnt mean it is enough competent to take up and process the nicked , and relaxed plasmid produced by the Linear amplification. so make your the efficiency of your competent cells if it is home made.

getting original plasmid suggests your Dpn digestion is not complete, so have a check over there as well.

Theoritically its true (strategenes guidelines) , but i personally dnt believe unless i see....anyways how you made sure your PCR worked??? did you see band with 30 cycle PCR?? how much PCR you run to check the band?? if it s just below 5% of total volume you may not see but i would suggest, after dpn digestion run the whole PCR and look for band, here you definitely shd see the band if your PCR worked, eventually you can do a gel purification and transformation of whole product or part of it depending on the band intensity....if not you still got to standardize your PCR rather than troubleshooting downstream.

good luck,
Gnana...
I would prefer being perfectionist rather than a passionist in Research.

I always had an alternate hypothesis....

#9 hln

hln

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 16 May 2012 - 11:36 AM

If you're getting that many mutant colonies, then either something is wrong with your miniprep (dirty or denatured DNA that resists DpnI digest) or your primers are binding in the wrong place. Try alternative primer design strategies, such as one described by Liu and Naismith, BMC Biotech 8:91.

#10 Alisa

Alisa

    member

  • Active Members
  • Pip
  • 6 posts
1
Neutral

Posted 17 May 2012 - 01:01 AM

View PostGNANA, on 16 May 2012 - 12:22 AM, said:

Reg your competent cells taking up the plasmid doesnt mean it is enough competent to take up and process the nicked , and relaxed plasmid produced by the Linear amplification. so make your the efficiency of your competent cells if it is home made.

getting original plasmid suggests your Dpn digestion is not complete, so have a check over there as well.

Theoritically its true (strategenes guidelines) , but i personally dnt believe unless i see....anyways how you made sure your PCR worked??? did you see band with 30 cycle PCR?? how much PCR you run to check the band?? if it s just below 5% of total volume you may not see but i would suggest, after dpn digestion run the whole PCR and look for band, here you definitely shd see the band if your PCR worked, eventually you can do a gel purification and transformation of whole product or part of it depending on the band intensity....if not you still got to standardize your PCR rather than troubleshooting downstream.

good luck,
Gnana...
I load 1/3 of my PCR product. Actually I am not sure my PCR works or not. I hope it's work! But I can't see band.
Thank you~

#11 Jason_LuYZ

Jason_LuYZ

    member

  • Active Members
  • Pip
  • 12 posts
2
Neutral

Posted 17 May 2012 - 03:43 AM

View PostAlisa, on 13 May 2012 - 07:49 PM, said:

Hi, I've done mutagenesis for 3 month, but until now all of my colonies are wild type. My vector is pDEST26 (7.3kb) and target gene is 3kb ,so total gene is about 12kb. I've try lots of conditions:

1. Used

Stragene QuikChange II site directed mutagenesis Kit



10x reation buf.   5ul
DNA template   50ng
f-primer   1ul
r-primer   1ul
dntp 1ul
ddH2O   36ul
pfu   1ul
TOTAL 50ul

95

℃-->1 min

95℃-->30sec
55℃-->1min
68℃-->12min  (30cycles)

68℃-->5min

DpnI digest for 1hr, add 4ul DpnI digested product to 50 ul competent cell(DH5a)

2ml SOC incubate 6hr

incubate on plate(amp+)

@this condition I have lots of colonies but they are not mutant!

2. Used

Stragene QuikChange II site directed mutagenesis Kit



I asked Stragene. They suggest that I can raise anneal tem. to Tm-3

℃.

So I change my tem to 62, again I can't get any mutatant!

3. Use pfu from fermantas  and change primer (design from

Stragene:  

QuikChange Primer Design)


I can't get any mutatant again!

I am no idea now!!

One of my friends said that I  should use

Stragene's pfu (for large vectors), it's that true? But it's so expensive!!


Anyone who has better ideas please tell me!
Thank you!

Hi, would you like to upload your primers? And the primer's Tm  should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong  the annealing time, I think this may affect the Pfu's high fidelity.

What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.

Moreover, I want to know whether you have make a control, no primer PCR group  and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.

I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)

I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have  lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or  less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.

Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.

#12 Alisa

Alisa

    member

  • Active Members
  • Pip
  • 6 posts
1
Neutral

Posted 17 May 2012 - 07:58 PM

View PostJason_LuYZ, on 17 May 2012 - 03:43 AM, said:

View PostAlisa, on 13 May 2012 - 07:49 PM, said:

Hi, I've done mutagenesis for 3 month, but until now all of my colonies are wild type. My vector is pDEST26 (7.3kb) and target gene is 3kb ,so total gene is about 12kb. I've try lots of conditions:

1. Used

Stragene QuikChange II site directed mutagenesis Kit




10x reation buf.   5ul
DNA template   50ng
f-primer   1ul
r-primer   1ul
dntp 1ul
ddH2O   36ul
pfu   1ul
TOTAL 50ul

95


℃-->1 min

95℃-->30sec
55℃-->1min
68℃-->12min  (30cycles)

68℃-->5min

DpnI digest for 1hr, add 4ul DpnI digested product to 50 ul competent cell(DH5a)

2ml SOC incubate 6hr

incubate on plate(amp+)

@this condition I have lots of colonies but they are not mutant!

2. Used

Stragene QuikChange II site directed mutagenesis Kit




I asked Stragene. They suggest that I can raise anneal tem. to Tm-3


℃.

So I change my tem to 62, again I can't get any mutatant!

3. Use pfu from fermantas  and change primer (design from

Stragene:  

QuikChange Primer Design)



I can't get any mutatant again!

I am no idea now!!

One of my friends said that I  should use

Stragene's pfu (for large vectors), it's that true? But it's so expensive!!



Anyone who has better ideas please tell me!
Thank you!

Hi, would you like to upload your primers? And the primer's Tm  should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong  the annealing time, I think this may affect the Pfu's high fidelity.

What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.

Moreover, I want to know whether you have make a control, no primer PCR group  and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.

I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)

I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have  lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or  less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.

Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.
HI

f-primer: ggatgcagaattccgacgtgactcaggatatgaag
r-primer: cttcatatcctgagtcacgtcggaattctgcatcc

this is my primer from stratgene primer design tool. But when I order primer from company, they gave me Tm just only 65℃.
I didn't do control!

Thanks for advise!

#13 Jason_LuYZ

Jason_LuYZ

    member

  • Active Members
  • Pip
  • 12 posts
2
Neutral

Posted 18 May 2012 - 11:28 PM

View PostAlisa, on 17 May 2012 - 07:58 PM, said:

View PostJason_LuYZ, on 17 May 2012 - 03:43 AM, said:

View PostAlisa, on 13 May 2012 - 07:49 PM, said:

Hi, I've done mutagenesis for 3 month, but until now all of my colonies are wild type. My vector is pDEST26 (7.3kb) and target gene is 3kb ,so total gene is about 12kb. I've try lots of conditions:

1. Used

Stragene QuikChange II site directed mutagenesis Kit






10x reation buf.   5ul
DNA template   50ng
f-primer   1ul
r-primer   1ul
dntp 1ul
ddH2O   36ul
pfu   1ul
TOTAL 50ul

95




℃-->1 min

95℃-->30sec
55℃-->1min
68℃-->12min  (30cycles)

68℃-->5min

DpnI digest for 1hr, add 4ul DpnI digested product to 50 ul competent cell(DH5a)

2ml SOC incubate 6hr

incubate on plate(amp+)

@this condition I have lots of colonies but they are not mutant!

2. Used

Stragene QuikChange II site directed mutagenesis Kit






I asked Stragene. They suggest that I can raise anneal tem. to Tm-3




℃.

So I change my tem to 62, again I can't get any mutatant!

3. Use pfu from fermantas  and change primer (design from

Stragene:  

QuikChange Primer Design)





I can't get any mutatant again!

I am no idea now!!

One of my friends said that I  should use

Stragene's pfu (for large vectors), it's that true? But it's so expensive!!





Anyone who has better ideas please tell me!
Thank you!

Hi, would you like to upload your primers? And the primer's Tm  should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong  the annealing time, I think this may affect the Pfu's high fidelity.

What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.

Moreover, I want to know whether you have make a control, no primer PCR group  and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.

I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)

I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have  lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or  less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.

Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.
HI

f-primer: ggatgcagaattccgacgtgactcaggatatgaag
r-primer: cttcatatcctgagtcacgtcggaattctgcatcc

this is my primer from stratgene primer design tool. But when I order primer from company, they gave me Tm just only 65℃.
I didn't do control!

Thanks for advis
Glad to see your primer  and you should calculate the Tm by yourself, but not using the Tm  provided by the primer-synthesis company.
Given you used Stratgene primer design tools, this may not have a severe problem, but I think the 12-17bp around both sides of  your mutated is good principle.

What's more, you may give me a short sequence(often a complete sequence is more important) containning your mutaed genes or amino acids(should tell me the translate sequence and your DNA sequence), I may help you design 1-2 primers for your disgining. The primer designing programe I used is DNAstar software. A strategy for make mutagenesis may change the Codon seqence but not affecting your amino acids due to the degeneracy of codon. Sometimes I use this to reduce mispairing by influenced by the mutated nucleotide sequence.

Edited by Jason_LuYZ, 19 May 2012 - 12:08 AM.


#14 CAT

CAT

    member

  • Active Members
  • Pip
  • 24 posts
0
Neutral

Posted 19 June 2012 - 12:30 PM

Well, I do not know where goes wrong. But maybe, your DPnI enzyme did not work well and your template DNA (WT) are not digested completely?

I just followed the protocol. XL-blue, rather than DH5alpha, should be used after mutagenesis. You may try.

#15 anf_zahra

anf_zahra

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 29 July 2012 - 05:57 PM

View PostJason_LuYZ, on 17 May 2012 - 03:43 AM, said:

View PostAlisa, on 13 May 2012 - 07:49 PM, said:

Hi, I've done mutagenesis for 3 month, but until now all of my colonies are wild type. My vector is pDEST26 (7.3kb) and target gene is 3kb ,so total gene is about 12kb. I've try lots of conditions:

1. Used

Stragene QuikChange II site directed mutagenesis Kit



10x reation buf.   5ul
DNA template   50ng
f-primer   1ul
r-primer   1ul
dntp 1ul
ddH2O   36ul
pfu   1ul
TOTAL 50ul


95

℃-->1 min

95℃-->30sec
55℃-->1min
68℃-->12min  (30cycles)

68℃-->5min

DpnI digest for 1hr, add 4ul DpnI digested product to 50 ul competent cell(DH5a)

2ml SOC incubate 6hr

incubate on plate(amp+)

@this condition I have lots of colonies but they are not mutant!

2. Used

Stragene QuikChange II site directed mutagenesis Kit



I asked Stragene. They suggest that I can raise anneal tem. to Tm-3

℃.

So I change my tem to 62, again I can't get any mutatant!

3. Use pfu from fermantas  and change primer (design from

Stragene:  

QuikChange Primer Design)


I can't get any mutatant again!

I am no idea now!!

One of my friends said that I  should use

Stragene's pfu (for large vectors), it's that true? But it's so expensive!!


Anyone who has better ideas please tell me!
Thank you!

Hi, would you like to upload your primers? And the primer's Tm  should be calculated according to the Stratgene's manuscripts.Your insert is about 3kb and your vector is about~7.3kb so why you calculated results is 12kb? If this, you should follow the 3Kb+7.3Kb=10.3Kb and could used the 10min 20seconds for you annealing time. If prolong  the annealing time, I think this may affect the Pfu's high fidelity.

What's more, you should make your Tm check, and you could have a gradient Tm PCR to see which Tm is Ok and the best choice is you'd better to rise your Tm to enhence the specificity and the mispairing, I had a case that I used a low Tm to perform my PCR but the mutant is sometimes wrong clone for the primer's binding problems. So the Tm is important to make a sense to your mutagenesis.

Moreover, I want to know whether you have make a control, no primer PCR group  and treatment same as your experimental group, If you done this, you may exclude the factor---Dpn I treatment. I usually use this for my trials, this is really important for convincing your results,after all identifying clones must be sequenced.

I have done many mutant, including 1-3 amino acids, deletion,replacement, etc. All use the 18cycles could work efficiently. The average mutagenesis efficiency reach almost 60%(Pick up 3 clones may gain at least 1 mutated clone)

I never purchase this high price strategene mutagenesis kit and just purchase the KOD-plus polymerase and Dpn I. The competent cells used is self-made. And the clones usually grow >100clones. I used this PCR reaction system to perform my mutagenesis: 20-40ng template for 50ul reaction volume(for my trials, I have  lowered the reaction volume to 25 ul) and the primer usually~ 1ul sometimes followed the stratgene's manuscripts it may calculated up to 1.1-1.3ul for 50 ul reaction vol.
And 10ul to run the 1% or  less concentration AGE for detection your PCR products usually it may never see band in your reaction system without primer. So usually, I could detect the amplification products in my PCR and followed the next Dpn I treatment( Just pipeting up 10-20ul pcr products and add 15-20U Dpn I for treating 1hr in water bath) and then used 1-2 ul transformed into 100ul E.coli JM109. and adding 800-900ul for further culture 45min-60min and spreadering on selective plate with 200ul cultures.

Sometimes the clones may be less but I still gained the clones and sometimes I gained more than 500 clones and randomly pick up 3 clones for sequencing could be enough gained at least correct clones! The clones usually is mutated or un-mutaed without mistakes. Maybe it is so luck for my trials, but I think it won't ony by fortune.

I am working on a site-directed mutagenesis, using pfu polymerase (Promega), and dpn1(NEB)


Here is my problem: My plasmid is 3.7kb big. Until now I can't figure out what's going wrong. I can not observe any bands in my gel(except faint band of primer dimers). also tried to transform after dpn1 digestion- no colonies to be seen.. ;(


i followed the protocol http://www.methodboo...pcr/pcrmut.html


but modified the cycle conditions as follows



1. 94 °C 2 min


2. 94 °C 30 sec
3. 65°C  30 sec(< 5°C less than my primers Tm-70 °C)


4. 72°C 2min/kb plasmid (so for my plasmid 7.5min)
5. 72°C 10min
Please suggest me if something is wrong with my method
Thanks in advance!!!

my topic : http://www.protocol-...cr-mutagenesis/







Also tagged with one or more of these keywords: mutagenesis, DpnI, Pfu

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.