Hey there!!
I want to do a promoter swap from CMV to PGK.I found some pgk promoter sequence from the forum here, but is that sufficient, or some extra enhancer is required? Which enhancer would work well with PGK? Also, does anyone happen to have PGK-GFP vector sequence or map?
Here's the sequence found here from the forum:
CCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCC
I don't want to use CMV promoter/enhancer due to CREB elements they contain (want to avoid neuronal activity-dependent expression).
Thanks so much,
and awesome weekend to all!
Mari, McGill uni
Does PGK promoter need enhancer? Anyone have PGK-GFP sequence?
Started by Fluorescent, Apr 27 2012 09:34 AM
PGK promoter enhancer
No replies to this topic
Also tagged with one or more of these keywords: PGK, promoter, enhancer
![]() |
Protocols and Techniques Forums →
Molecular Cloning →
Promoter distance from ATGStarted by Guest_miST32_* , 17 Jun 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
Molecular Biology →
Weak promoter activity in pGL3 reporter assayStarted by Guest_srpres_* , 24 May 2013 |
|
|
|
Protocols and Techniques Forums →
Molecular Cloning →
What is a fos-pomoter and what does SV40 late pA do?Started by Guest_Joanna_Andersen_* , 10 Feb 2013 |
|
|
||
Protocols and Techniques Forums →
Molecular Biology →
a promoter question, two promoter cassetts-related expressionStarted by Guest_gyma_* , 16 Dec 2012 |
|
|
||
Protocols and Techniques Forums →
Molecular Cloning →
How would you find a certain tissue specific promoter for my construct?Started by Guest_assembler01_* , 13 Nov 2012 |
|
|














