Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Does PGK promoter need enhancer? Anyone have PGK-GFP sequence?

PGK promoter enhancer

  • Please log in to reply
No replies to this topic

#1 Fluorescent

Fluorescent

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 27 April 2012 - 09:34 AM

Hey there!!

I want to do a promoter swap from CMV to PGK.I found some pgk promoter sequence from the forum here, but is that sufficient, or some extra enhancer is required? Which enhancer would work well with PGK? Also, does anyone happen to have PGK-GFP vector sequence or map?

Here's the sequence found here from the forum:
CCGGTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCC

I don't want to  use CMV promoter/enhancer due to CREB elements they contain (want to avoid neuronal activity-dependent expression).

Thanks so much,
and awesome weekend to all!

Mari, McGill uni





Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.