Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

MSP Primers not working

Methylation PCR Primers

  • Please log in to reply
6 replies to this topic

#1 FolateGirl

FolateGirl

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 20 April 2012 - 02:16 AM

Hi Everyone

This is my first post here. I'm looking to see whether methylation is occuring in the promoter region of the bax gene, so i've found the promoter region;

TAATAATAATAATAATGTGTATACCCATGTAAACACCATTCAGATAAAAA
TATGGCATATTTGGGGCACCCGGGGAGTGTCTCTTGTGGCCCCTCCCCTC
CATACCCTGCTGATCTATCAGCACAGATTAGTTTCTGCCACTTTTTAAAC
TTCATATTCCTTTTCTTTTTACACAAACACAAACATTCGAGTCATGACTG
GGTGGGGTGGCTCAAGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGC
GAGGATCGCTTGAGTCTGGGAGTTCAGAGACCAGCCTGGGCAACATAGAG
AGACCTCATCTCCACATAAAAAGTTTTAAAAATTAACCAGGGGCGGTGTA
GTCCCAGCTACTCAGGAGGCTGAGGTGGGAGGCTTCAGCCCGGGAATTCC
AGACTGCAGTGAGCCATGATTGGGCCACTGCACTCCAGCCTGGGCAACAC
AGTGAGACCCTGTCTCAAAAAAAAAAAAAAAAAAAACAGGAAAAAACAAA
CAAACAGAAAAGCAGGCCTGGCGCGGTAGCTCATGCCTGTAATCCCAGCG
CTTTGGAAGGCTGAGACGGGGTTATCTCTTGGGCTCACAAGTTAGAGACA
AGCCTGGGCGTGGGCTATATTGCTAGATCCAGGTCTCTGCAAAAAACAAA
ACCACTCAGTTTTTAGTCATCTATAACGTCCTGCCTGGAAGCATGCTATT
TTGGGCCTCTGAGCTTTTGCACTTGCTAATTCCTTCTGCGCTGGGGAGAG
CTCAAACCCTGCCCGAAACTTCTAAAAATGGTGCCTGGATAAATGAAGGC
ATTAGAGCTGCGATTGGACGGACGGCTGTTGGACGGCGCCACTGCTGGCA
CTTATCGGGAGATGCTCATTGGACAGTCACGTGACGGGACCAAACCTCCC
GAGGGAGCGAGGCAGGTGCGGTCACGTGACCCGGCGGCGCTGCGGGGCAG
CGGCCATTTTGCGGGGCGGCCACGTGAAGGACGCACGTTCAGCGGGGCTC

Then have used the MethPrimer Program to design Primers which are these;

MS: GGG AGA GTT TAA ATT TTG TTC G
MAs: ATA CCA ACA ATA ACG CCG TC

US: GGG AGA GTT TAA ATT TTG TTT G
UAs: AAA TAC CAA CAA TAA CAC CAT C

I've tried different annealing temperatures, and have tried them on bisulphite treated DNA, and that which hadn't been treated. Still no bands visualised when i've run a gel. Any ideas where i'm going wrong or what I could try next?

Thanks

#2 lmg

lmg

    member

  • Active Members
  • Pip
  • 20 posts
1
Neutral

Posted 20 April 2012 - 04:17 AM

hi,

i haven't checked if your primers are OK (technically), but would recommend if you tried Q solution from Qiagen.

I had problems with one product, and this Q solution helped. I use it with HotStart polymerase.

lmg

#3 katjaze

katjaze

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 21 April 2012 - 01:49 AM

I also deeply recommend using the HotStart Taq poly (Qiagen) and Q substance. I used 2x Gold Master Mix, Applied Biosystems and have never got the bands. Situation has changed with Qiagen HOtStart Taq and Q.

Best, Katja

#4 FolateGirl

FolateGirl

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 23 April 2012 - 04:56 AM

Thank you! I'm also going to try a gradient PCR and see if that works. Thanks for your help

#5 katjaze

katjaze

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 23 April 2012 - 12:48 PM

If you want, inform me on your results :)

#6 amrwaly

amrwaly

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 21 May 2012 - 01:02 PM

Hi
katjaze... I used 2x Gold Master Mix, Applied Biosystems and have never got the bands...


Do u mean the : Ampli-Taq Gold 360 Master Mix ?? i ordered it already...








#7 katjaze

katjaze

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 10 June 2012 - 05:19 AM

Armwaly, it was just Ampli Taq Gold Master Mix (http://tools.invitro.../cms_041165.pdf), it was not 360.. I hope your MSP experiments would be ok!

Best, Katja





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.