Hey Everyone!!!
I was hoping you would let me pick your brain for a little while, as I am having PCR problems.
I recently used your guidelines from the following website to design my PCR primes:
http://www.biochem.u...cols/oligo.html
Unfortunately, I was not successful in amplifying the gene.
First off, I am using total cDNA. So in other words, I used total RNA in an RT reaction w/ random primers and got total cDNA.
Second, my primers were designed almost identical to the example on this web page, except the start and stop codons are within the bound primer sequence. I used my vector specific restriction enzyme sites ( HindIII and EcoRI), the random bases, and the GC clamp. see my primers below:
orange = GC clamp
red = restriction site
underlined = gene specific sequence
Note: Only the 20 gene specific bases are important to attaching to the sequence, right?
5’ CGCCGTTCAGGAATTCTGCAAGGCCATGCTGGCTTG 3’
3’ TCCCGTTTACTGTCCGTGGGTTCGAAATTCACGGCG 5’
Third, a colleague of mine said that the primers are too long, and suggested that I use the melting point of the bases that are binding to the cDNA as opposed the Tm of the entire oligo which is obviously different. I’m concerned that the part of the oligo that is not bound to the cDNA is causing the primer not to bind to the template.
I also think I may need to increase the template amount since it is total cDNA. I used about 1 ug previously. Any advice you can give me would be appreciated.
I used HotStar HF polymerase from QIAgen and my product 1-2kb
Cloning HELP- Possible Primer issues
Started by nicoleallenia, Apr 12 2012 10:40 AM
primers cDNA PCR Cloning
6 replies to this topic
#1
Posted 12 April 2012 - 10:40 AM
#2
Posted 12 April 2012 - 01:14 PM
If you have ordered the reverse primer as written without horizontally flipping, the primer will not work. due to the presence of the tail inside the specifc sequence.
You reverse primer also has a relatively high chance of forming hairpin loops due to the runs of G and C in the specific part. Try adding DMSO to the PCR at 1 ul/20 ul reaction.
Despite what the website says, I would avoid a GC clamp on the 5' end as this increases the chance of the tail non-specifically binding, which will play havoc with your PCR.
I think your template amount should be fine, unless you are after a low abundance sequence.
Your colleague is correct, only the specific part of the primer should be used in the Tm calculation.
You reverse primer also has a relatively high chance of forming hairpin loops due to the runs of G and C in the specific part. Try adding DMSO to the PCR at 1 ul/20 ul reaction.
Despite what the website says, I would avoid a GC clamp on the 5' end as this increases the chance of the tail non-specifically binding, which will play havoc with your PCR.
I think your template amount should be fine, unless you are after a low abundance sequence.
Your colleague is correct, only the specific part of the primer should be used in the Tm calculation.
#3
Posted 12 April 2012 - 08:50 PM
what are the random bases between the GC clamp and RE site for? for better digestion?....just like bob1, I would either avoid the GC clamp, or avoid the random bases. If you really need the GC clamp, then remove the random bases, because the GC clamp would act as the neccessary additional nts. The length of overhang nucleotides depends on the enzyme you use too. EcoRI doesn't really need 5 nt overhang. you can reduce that. check NEB or Fermentas websites, they have a guide for that.
#4
Posted 13 April 2012 - 08:03 AM
Thanks for replying!!! So concerning the GC clamp issue, if I digested the primer before I used it in the PCR reaction that would help reduce the Total Tm and avoid the possibility of non-specific binding due the the clamp. Also, the gene products should have the same cut restriction sites, correct? Perhaps I should just buy new primers, what you think?
#5
Posted 13 April 2012 - 02:04 PM
I'm affraid you can't digest primers. First EcoRI won't cut ssDNA, and second even if that was theoretically possible, you would produce AATT overhang only, which would amplify to a double-stranded sequence with no overhang and now incomplete recognition site.
Buying new primers would be better.
Buying new primers would be better.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.
I never trust anything that can't be doubted.
I never trust anything that can't be doubted.
#6
Posted 19 April 2012 - 10:35 AM
So, I've checked my RNA and cDNA to make sure those were good and everything is fine. So, I'm going to order new primers.
Just a quick question, when I design these new primers the 20bp length is including the restriction site add on correct? Also, should I I design the primers before the start codon and after the stop codon to insure that the entire gene is amplified and should the primers have the start and stop codon within the sequence?
Just a quick question, when I design these new primers the 20bp length is including the restriction site add on correct? Also, should I I design the primers before the start codon and after the stop codon to insure that the entire gene is amplified and should the primers have the start and stop codon within the sequence?
#7
Posted 19 April 2012 - 11:46 AM
No, you need to design the primers this way:
5' GTTT GAATTC <20 bp match to your sequence> 3' (this is some junk DNA to allow the RE to cut, followed by the RE site, followed by the primer binding region for your gene)
The reverse primer should look exactly the same (possibly a different RE site) with the 20 bp match to the reverse complement of your gene. You get to decide how much of your gene you want, and whether to include the start and stop codons, but usually you would want them.
If your primer is 20 bp total long, and includes a RE site, then you almost certainly have insufficient binding to your target, and even if the primer worked, without the 5' junk bases, you likely would not be able to cut it.
5' GTTT GAATTC <20 bp match to your sequence> 3' (this is some junk DNA to allow the RE to cut, followed by the RE site, followed by the primer binding region for your gene)
The reverse primer should look exactly the same (possibly a different RE site) with the 20 bp match to the reverse complement of your gene. You get to decide how much of your gene you want, and whether to include the start and stop codons, but usually you would want them.
If your primer is 20 bp total long, and includes a RE site, then you almost certainly have insufficient binding to your target, and even if the primer worked, without the 5' junk bases, you likely would not be able to cut it.
Also tagged with one or more of these keywords: primers, cDNA, PCR, Cloning
![]() |
Protocols and Techniques Forums →
Molecular Biology →
Cloning cDNA construct into E.Coli.Started by Guest_rjiyer_* , 11 Jun 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
cDNA amount in qPCRStarted by Guest_Dupasch_* , 09 Jun 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
ChIP and Next Generation Sequencing →
|
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
Real-time efficiency questionStarted by Guest_alreese13_* , 05 Jun 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
qPCR question (no results?)Started by Guest_LQJ_* , 31 May 2013 |
|
|














