Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Cloning HELP- Possible Primer issues

primers cDNA PCR Cloning

  • Please log in to reply
6 replies to this topic

#1 nicoleallenia

nicoleallenia

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 12 April 2012 - 10:40 AM

Hey Everyone!!!

I was hoping you would let me pick your brain for a little while, as I am having PCR problems.

I recently used your guidelines from the following website to design my PCR primes:

http://www.biochem.u...cols/oligo.html

Unfortunately, I was not successful in amplifying the gene.

First off, I am using total cDNA. So in other words, I used total RNA in an RT reaction w/ random primers and got total cDNA.

Second, my primers were designed almost identical to the example on this web page, except the start and stop codons are within the bound primer sequence. I used my vector specific restriction enzyme sites ( HindIII and EcoRI), the random bases, and the GC clamp. see my primers below:

orange = GC clamp
red    = restriction site
underlined = gene specific sequence

Note: Only the 20 gene specific bases are important to attaching to the sequence, right?

5’ CGCCGTTCAGGAATTCTGCAAGGCCATGCTGGCTTG 3’

  
3’ TCCCGTTTACTGTCCGTGGGTTCGAAATTCACGGCG 5’  


Third,  a colleague of mine said that the primers are too long, and suggested that I use the melting point of the bases that are binding to the cDNA as opposed the  Tm of the entire oligo which is obviously different.  I’m concerned that the part of the oligo that is not bound to the cDNA is causing the primer not to bind to the template.

I also think I may need to increase the template amount since it is total cDNA.  I used about 1 ug previously.  Any advice you can give me would be appreciated.

I used HotStar HF polymerase from QIAgen and my product 1-2kb

#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 4,425 posts
233
Excellent

Posted 12 April 2012 - 01:14 PM

If you have ordered the reverse primer as written without horizontally flipping, the primer will not work. due to the presence of the tail inside the specifc sequence.

You reverse primer also has a relatively high chance of forming hairpin loops due to the runs of G and C in the specific part.  Try adding DMSO to the PCR at 1 ul/20 ul reaction.


Despite what the website says, I would avoid a GC clamp on the 5' end as this increases the chance of the tail non-specifically binding, which will play havoc with your PCR.

I think your template amount should be fine, unless you are after a low abundance sequence.

Your colleague is correct, only the specific part of the primer should be used in the Tm calculation.

#3 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 981 posts
45
Excellent

Posted 12 April 2012 - 08:50 PM

what are the random bases between the GC clamp and RE site for? for better digestion?....just like bob1, I would either avoid the GC clamp, or avoid the random bases. If you really need the GC clamp, then remove the random bases, because the GC clamp would act as the neccessary additional nts. The length of overhang nucleotides depends on the enzyme you use too. EcoRI doesn't really need 5 nt overhang. you can reduce that. check NEB or Fermentas websites, they have a guide for that.

#4 nicoleallenia

nicoleallenia

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 13 April 2012 - 08:03 AM

Thanks for replying!!!  So concerning the GC clamp issue, if I digested the primer before I used it in the PCR reaction that would help reduce the Total Tm and avoid the possibility of non-specific binding due the the clamp. Also, the gene products should have the same cut restriction sites, correct?    Perhaps I should just buy new primers, what you think?

#5 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 950 posts
67
Excellent

Posted 13 April 2012 - 02:04 PM

I'm affraid you can't digest primers. First EcoRI won't cut ssDNA, and second even if that was theoretically possible, you would produce AATT overhang only, which would amplify to a double-stranded sequence with no overhang and now incomplete recognition site.
Buying new primers would be better.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#6 nicoleallenia

nicoleallenia

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 19 April 2012 - 10:35 AM

So,  I've checked my RNA and cDNA to make sure those were good and everything is fine.  So, I'm going to order new primers.

Just a quick  question, when I design these new primers the 20bp length is including the restriction site add on correct?  Also, should I I design the primers  before the start codon and after the stop codon to insure that the entire gene is amplified and should the primers have the start and stop codon within the sequence?

#7 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,846 posts
142
Excellent

Posted 19 April 2012 - 11:46 AM

No, you need to design the primers this way:

5' GTTT GAATTC <20 bp match to your sequence> 3'  (this is some junk DNA to allow the RE to cut, followed by the RE site, followed by the primer binding region for your gene)

The reverse primer should look exactly the same (possibly a different RE site) with the 20 bp match to the reverse complement of your gene.  You get to decide how much of your gene you want, and whether to include the start and stop codons, but usually you would want them.

If your primer is 20 bp total long, and includes a RE site, then you almost certainly have insufficient binding to your target, and even if the primer worked, without the 5' junk bases, you  likely would not be able to cut it.





Also tagged with one or more of these keywords: primers, cDNA, PCR, Cloning

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.