Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

42bp fragment ligation to 4776bp vector


  • Please log in to reply
3 replies to this topic

#1 yanggerzi

yanggerzi

    member

  • Members
  • Pip
  • 5 posts
0
Neutral

Posted 19 June 2003 - 08:56 AM

Dear all , please help me, I am crazy about the issue

I have been in trouble with a special ligation :

Vector: 4776bp, digested by SnaBI, BamHI,
Insert: 42bp and 28 bp which was seperately synthesized as the following:

VL42 XinF: ATAAGTAATTTTCTTTTCGTAACAAATTAAAAAATATAAATG Tm: 53.2 GC: 20.0
VL42XinR: BamHI GATCCATTTATATTTTTTAATTTGTTACGAAAAGAAAATTACTTAT Tm: 582.6 GC; 16


VL 28 XinF: ATAAGTATTTTTCTTTTCGTAACAGTTTG Tm: 52.8 GC: 24.0
VL 28 XinR: BamHI GATCCAAACTGTTACGAAAAGAAAAATACTTAT Tm: 59.5 GC: 32.0

First annealing as : F: 50uM( not exactly ) 20ul
R: 50uM ( not exactly ) 20ul
NEB T4 ligation buffer: 5ul
ddH2O: 5ul
95C, 5minutes
Cool at RT for one hour.

Ligation as : Vector 1ul ( about 80ng,guessed from it's bright compared with Marker)
Annealing fragment: 5ul
T4 ligation buffer: 1ul
T4 ligase: 2ul ( 400 unit/ul)
ddH2O: 2ul
16C, overnight, then 4C, 16hrs.

In case of the vector has not been completely cutted, after ligation as the above,

Digest as : Ligation 10ul
SnabI ; 1ul
SnabI buffer: 1ul
37C, 5 hr
Transform by TSS method.

I have tried three time but never get success. Could you please give me some professional comment on the protocol
Any commet would be highly appeciated. I am looking forward to your quick reply.

Best Regard.

Lillian

#2 yossi.b

yossi.b

    member

  • Active Members
  • Pip
  • 11 posts
0
Neutral

Posted 19 June 2003 - 11:44 PM

after annealing the oligo will look like below where is the snabi restriction site ? even the
BAmHi site is not completly. u must have the two restriction sites in the insert when u cut the vecgor with this two enzymes.

5' ATAAGTAATTTTCTTTTCGTAACAAATTAAAAAATATAAATG 3'
3' TATTCATTAAAAGAAAAGCATTGTTTAATTTTTTATATTTACCTAG 5'

SnaBI TAC'GTA BamHI G'GATC_C

please clarify your question and i promise full attention to your problem

good luck yossi u can write to my e-mail too.

#3 yanggerzi

yanggerzi

    member

  • Members
  • Pip
  • 5 posts
0
Neutral

Posted 20 June 2003 - 07:31 AM

Thank you for you attention. Let me explain more details:
1. There are SnabI and BamHi in the vector, so I first Digest the vector with the Two enzyme.
1. The SnabI is blunt end, so there is no need to set its at the fragment, after anneling there is blunt end at one of the fragment. For BamhI. As the same reason, no need to get full BamhI sequence on the fragment, because the vector will give the stick end comlemented.
3. why I use SnabI to digest the ligation system after ligation is in case of there still some vectors uncutted. I have to use pcr method to select my objective clone, so I have to reduce the possibility of vetor self- ligation.

Looking forward to your reply

Thank you.

Lillian

#4 zingmatter

zingmatter

    member

  • Members
  • Pip
  • 5 posts
0
Neutral

Posted 23 June 2003 - 06:03 AM

Are you sure the 5' ends of each oligo have been phosphorylated when synthesized? Else the ligation won't work (probably a bit of an obvious suggestion - sorry). The ligation you are trying to do is quite difficult (blunt end ligations are tricky in my experience) and your insert is small. You could try to improve the changes of a successful ligation by increasing the amount of ligase you use, add extra ATP to the reaction (I think - check this), but best of all - do the ligation by cycling the temperature of the reaction between 4 and 20oC. One last suggestion, try adding PolyEthyleneGlycol (PEG) to your ligation buffer (to about 10%).

Hope this helps

zing




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.