DNA Construction: HIV-1 Tat Gene
Started by yoshi, Mar 19 2012 03:03 AM
9 replies to this topic
#1
Posted 19 March 2012 - 03:03 AM
Hi all, I am currently trying to make a DNA construct that includes the Tat gene of HIV-1. This gene consists of 2 exons and the second exon has 2 stop codons.
I am interested in getting the longer variant (101 a.a. residues) of the protein encoded, ie. one of which the translation stops at the second stop codon. And a search of commercially available plasmid vectors carrying this gene include both stop codons. and in these plasmid vectors, the 2 exons are separated, unlike in my construct.
So my question is: Should I include the first stop codon in my construct, or should I remove it as there is no way I can tell if my full construct, which contains many other non-HIV elements as well, is 'native' enough for the translation machinery to ignore the first stop and proceed until the second one.
Thanks in advance.
I am interested in getting the longer variant (101 a.a. residues) of the protein encoded, ie. one of which the translation stops at the second stop codon. And a search of commercially available plasmid vectors carrying this gene include both stop codons. and in these plasmid vectors, the 2 exons are separated, unlike in my construct.
So my question is: Should I include the first stop codon in my construct, or should I remove it as there is no way I can tell if my full construct, which contains many other non-HIV elements as well, is 'native' enough for the translation machinery to ignore the first stop and proceed until the second one.
Thanks in advance.
#2
Posted 19 March 2012 - 03:23 AM
AFAIK the first "stop codon" of Tat (resulting in 86AA Tat) is not present in wildtype HIV. It's hard to come by the long version though... Anyway, you should avoid premature stop codons, if you want the full length Tat.
I got soul, but I'm not a soldier
#3
Posted 19 March 2012 - 03:26 AM
Rsm, on 19 March 2012 - 03:23 AM, said:
AFAIK the first "stop codon" of Tat (resulting in 86AA Tat) is not present in wildtype HIV. It's hard to come by the long version though... Anyway, you should avoid premature stop codons, if you want the full length Tat.
But it is found in, for example, HXB2 and NL4-3, no?
#4
Posted 19 March 2012 - 04:18 AM
"Of interest, it should be noted that whereas an 86-amino acid form of Tat, which exists for a few laboratory- passaged virus strains (e.g. LAI, HXB2, pNL4–3), has been frequently used; this version represents a truncated and not naturally full-length protein. Indeed, a single nucleotide change in LAI, HXB2, and/or pNL4–3 at putative residue 87 unmasks in these respective genomes the conserved 101 amino acids of Tat that are found in most in vivo isolates of virus. This suggests that the premature termination codon that exists in laboratory isolates at position 87 conceivably arose artifactually during tissue culture passaging." from "Multifaceted Activities of the HIV-1 Transactivator of Transcription, Tat" Jeang KT, Xiao H, Rich EA. J Biol Chem. 1999 Oct 8;274(41):28837-40.
I got soul, but I'm not a soldier
#5
Posted 19 March 2012 - 05:47 AM
Rsm, on 19 March 2012 - 04:18 AM, said:
"Of interest, it should be noted that whereas an 86-amino acid form of Tat, which exists for a few laboratory- passaged virus strains (e.g. LAI, HXB2, pNL4–3), has been frequently used; this version represents a truncated and not naturally full-length protein. Indeed, a single nucleotide change in LAI, HXB2, and/or pNL4–3 at putative residue 87 unmasks in these respective genomes the conserved 101 amino acids of Tat that are found in most in vivo isolates of virus. This suggests that the premature termination codon that exists in laboratory isolates at position 87 conceivably arose artifactually during tissue culture passaging." from "Multifaceted Activities of the HIV-1 Transactivator of Transcription, Tat" Jeang KT, Xiao H, Rich EA. J Biol Chem. 1999 Oct 8;274(41):28837-40.
Thanks! Do you have any experience in constructing the Tat gene? Do you change the premature Stop codon to Serine (TAG to TCG), since Serine is the amino acid residue present in SF2 in place of the Stop codon in other strains, or to other amino acid residues?
#6
Posted 19 March 2012 - 07:31 AM
Serine, TCG. I got the pcDNA3-Tat-HA from Matija Peterlin via Addgene (http://www.addgene.org/14654/). That Tat has the sequence: ATGGAGCCAGTAGATCCTAATCTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAGGACTGCTTGTAACAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCTACGCGTGTTTCACAAGAAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCCTCAGGACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAACCCGCCTCCCAGTCCCGAGGGGACCCGACAGGGCCCACGGAATCGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCGTTCGATTACCCATACGATGTTCCAGATTACGCTGCCTGA
I got soul, but I'm not a soldier
#7
Posted 19 March 2012 - 09:20 AM
Rsm, on 19 March 2012 - 07:31 AM, said:
Serine, TCG. I got the pcDNA3-Tat-HA from Matija Peterlin via Addgene (http://www.addgene.org/14654/). That Tat has the sequence: ATGGAGCCAGTAGATCCTAATCTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAGGACTGCTTGTAACAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCTACGCGTGTTTCACAAGAAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCCTCAGGACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAACCCGCCTCCCAGTCCCGAGGGGACCCGACAGGGCCCACGGAATCGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCGTTCGATTACCCATACGATGTTCCAGATTACGCTGCCTGA
Hey man, thanks! But this sequence codes for more than 101 a.a. residues. Strange. Anyway, I have aligned the Tat gene sequence from 8 different HIV-1 strains. Of these 8, 4 have a premature stop codon, 3 have a serine in place of the premature stop codon and the last one has a glutamine.
So I will construct a Tat gene with a serine residue. Thanks a lot!! You've been a star!
#8
Posted 19 March 2012 - 10:12 AM
TACCCATACGATGTTCCAGATTACGCT is the HA tag YPYDVPDYA.
I got soul, but I'm not a soldier
#9
Posted 19 March 2012 - 10:14 AM
Anyway, I just happen to have had the same problem... I also realized that overexpression of Tat is very toxic to mammalian cells (membrane-permeabilizing protein). So good luck with your experiment.
I got soul, but I'm not a soldier
#10
Posted 19 March 2012 - 10:22 AM
Rsm, on 19 March 2012 - 10:14 AM, said:
Anyway, I just happen to have had the same problem... I also realized that overexpression of Tat is very toxic to mammalian cells (membrane-permeabilizing protein). So good luck with your experiment.













