Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Amplicon side products

qPCR Amplicon Primer specificity quantification

  • Please log in to reply
5 replies to this topic

#1 Le_Bioguy

Le_Bioguy

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 20 February 2012 - 07:51 AM

Hello everybody,

I am new to primer design and just worked my way into using Primer3 and Primer-Blast, but I still have a question. I want to perform a qPCR in order to quantify the amount of gene specific transcripts of the tumor protein p63. In order to do that I designed primer covering all known transcripts of that gene and checked them with nucleotide blast for specificity. They all turned out fine with an e-value of 0.015 and query coverage of 100%. The problem now is my primer also show 75 or 80% query coverage to other not wanted transcripts and therefore produce amplicon side products besides my amplicon of interest, which I will detect later on using SYBR green. How much of a problem is this since my amplicon side products are over 400 and 1000bp long?

Thanks in advance for your replies!

Edited by Le_Bioguy, 20 February 2012 - 07:52 AM.


#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 943 posts
66
Excellent

Posted 21 February 2012 - 12:06 PM

Depends on number of mismatches (that can be affected by annealing temperature) and position of mismatches. Generaly mismatches on 3' end won't amplify.
Also in real time longer amplicons (like 1000bp) can be eliminated by short extension time.
Can you post the results of Primer-BLAST?
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#3 Le_Bioguy

Le_Bioguy

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 22 February 2012 - 01:08 AM

Yes, of course, I can do that! Here you go: (tha transcripts I want to quantify are the first three ones)

Products on target templates
>NM_001114979.1 Homo sapiens tumor protein p63 (TP63), transcript variant 3, mRNA
product length = 187
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 393  ....................  412

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 579  ....................  560

>NM_001114978.1 Homo sapiens tumor protein p63 (TP63), transcript variant 2, mRNA
product length = 187
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 393  ....................  412

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 579  ....................  560

>NM_003722.4 Homo sapiens tumor protein p63 (TP63), transcript variant 1, mRNA
product length = 187
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 393  ....................  412

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 579  ....................  560

>NM_001243467.1 Homo sapiens ubiquitin associated and SH3 domain containing A (UBASH3A), transcript variant 3, mRNA
product length = 1833
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 2183  C.....TT.T.G........  2164

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 351  A.A..TC.............  370

>NM_001001895.2 Homo sapiens ubiquitin associated and SH3 domain containing A (UBASH3A), transcript variant 2, mRNA
product length = 2050
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 2400  C.....TT.T.G........  2381

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 351  A.A..TC.............  370

>NM_018961.3 Homo sapiens ubiquitin associated and SH3 domain containing A (UBASH3A), transcript variant 1, mRNA
product length = 2164
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 2514  C.....TT.T.G........  2495

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 351  A.A..TC.............  370

>NM_019106.5 Homo sapiens septin 3 (SEPT3), transcript variant B, mRNA
product length = 630
Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 1982  .A..A..G.......A....  1963

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 1353  T.T....CA..........G  1372

>NM_024827.3 Homo sapiens histone deacetylase 11 (HDAC11), transcript variant 1, mRNA
product length = 207
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 2347  TC.....A..T.......A.  2328

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 2141  G..T.CC.........G...  2160

>NM_001136041.2 Homo sapiens histone deacetylase 11 (HDAC11), transcript variant 2, mRNA
product length = 207
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 2246  TC.....A..T.......A.  2227

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 2040  G..T.CC.........G...  2059

>NM_001607.3 Homo sapiens acetyl-CoA acyltransferase 1 (ACAA1), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA
product length = 876
Forward primer  1 GACCTGAGTGACCCCATGTG  20
Template 1581  .TG......TTT........  1562

Reverse primer  1 CGGGTGATGGAGAGAGAGCA  20
Template 706  ..CT.........AG...A.  725

Edited by Le_Bioguy, 22 February 2012 - 01:09 AM.


#4 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 943 posts
66
Excellent

Posted 22 February 2012 - 01:15 PM

Formating gets messed here, so I put the primers to PrimerBLAST myself.

I would say:
UBASH3A binds on 3' end, but there are quite some mismatches and some of them in the middle, and the product is over 1000. Wouldn't bother with that.
Others have mismatches on or close the 3' end, so I wouldn't bother about that neither.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#5 Le_Bioguy

Le_Bioguy

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 24 February 2012 - 03:13 AM

Thanks Brain on a stick! I also talked with a co-worker of mine and she told me the same thing!

#6 calou

calou

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 07 March 2012 - 12:20 AM

I sugest you to use directly "getprime":http://updepla1srv1.epfl.ch/getprime/. This tools allows you to design the best qPCR primers covering all the transcripts of a gene and the pipeline controls automatically if the primers are specific only to these transcripts also (if it is not specific, it gave you a "non-specific" error).
I have good experience into this tool, please tell me if you have any questions.





Also tagged with one or more of these keywords: qPCR, Amplicon, Primer, specificity, quantification

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.