Jump to content


- - - - -

Determining gene of interest from Cell culture lines


2 replies to this topic

#1 Byong

    member

  • Members
  • Pip
  • 4 posts

Posted 24 January 2012 - 06:29 PM

Hi there, I am a summer research student currently performing PCRs to check for the presence of opioid receptors in various cell lines.

What I've done so far is to extract mRNA from cell cultures (e.g. 4T1, Raw 264.7 and H5V), doing a reverse transcription and performing PCRs on the cDNA to check if there are any opioid receptors present.

My PCRs have been very inconclusive ( I usually get primer dimers) so I'm trying to check and see if my primers will actually work on the cell lines.

However! BLAST is extremely confusing and I have no idea if it's possible to check my primer design against cell lines. Where can I get the genomic sequence for 4T1, H5v etc, etc.

Please, any enlightenment on the topic will be most appreciated!

~Byong

#2 bob1

    Hmmm, I think it's working

  • Active Members
  • PipPipPipPipPip
  • 3,047 posts

Posted 25 January 2012 - 01:12 PM

Most cell lines have not had their individual genomes sequenced, so you will not find them on the NCBI website.

You should look to check if your primers are specific for cDNA (i.e. no introns) or if they will work with genomic DNA (introns and exons), and the size of the product. You can use Primer BLAST (on the NCBI website) for this.

Have you performed much PCR before? It may be that you are having some sort of methodological issues. If you can get someone experienced to watch you as you do the PCR, it may help you to get your assays running. It would also be helpful if you have a positive control for the opiod receptors that you can run with each PCR to ensure that it is working correctly.

#3 Byong

    member

  • Members
  • Pip
  • 4 posts

Posted 26 January 2012 - 05:46 PM

Thank you for replying! Posted Image

Yes, I only realised that after hours of pondering it over and smashing keys on the NCBI site.

On using Primer Blast, these are the results I've gotten from one of my primer pairs:


Input PCR template none Specificity of primers No target templates were found in selected database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) (Organism limited to Mus musculus) Other reports Search Summary
Detailed primer reports
Primer pair 1
Sequence (5'->3') Length Tm GC% Self complementarity Self 3' complementarity Forward primer GAGAGCTCGCGGCCCGCTACCTGATGGGAACGTGC 35 72.80 68.57 9.00 5.00 Reverse primer GGAAGCTTGAATTCGGAGGGGTGTTCCCTAGTGT 34 65.45 52.94 6.00 2.00

Could you explain what it means by values in the self complementarity columns? Is there an acceptable minimum/maximum value? I must note that I've only been getting primer dimers with all my mouse and human opioid primer pairs.


I've only had about 3-4 months worth of experience over a 2 year period, but my non-opioid PCRs ( performed with GAPDH) have worked ( although I've been getting contamination in my no-RT controls). As for positive controls, I'm supposed to be receiving some mouse brain which is positive for opioid receptors but that is a matter stuck in limbo .





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.