Jump to content


Designing primers for miRNA located on minus strand.

miRNA Primers antisense

2 replies to this topic

#1 aazmaish

    member

  • Active Members
  • Pip
  • 8 posts

Posted 12 January 2012 - 01:49 PM

Hi,
I am very new to miRNA field. My supervisor said me to design primers for a miRNA located on minus strand of the genome. That miRNA is located in noncoding region of the genome.
I need help in designing primers. For example following is the sequence of the plus strand. what could be the primers of this sequence which could give a PCR product which i can clone in a lenti vector, and can get miRNA expression.

5' TGTGTTAAAATCTGAAGTTCTTTGTTTGTGTCTTCTGTGTCTGGAAAAGGGAGGGGGCCTTAGCTACACA
TGGCTACAGTAAAAAAGCTGACTATAAGGCTAATCATCTCAGGGGCTTTATGACCAGGTCTAAATGCTGC
TTTTATGCTTCTGGTAATAAGGCAACACATATAGACACACTACCCTGATGAAGTGGTGTCTATGATGCGC
CTTCTTTCCAGTAAGCCAAGTATTCTCGAAGGAGTTCGGGACCTTAGGTCATATCACACCCCGCTGGTAA 3'
Please help, and thanks in advance.

#2 pcrman

    Epigenetist

  • Moderator
  • PipPipPipPipPip
  • 815 posts

Posted 12 January 2012 - 08:19 PM

You can use the reverse-complementary sequence to design cloning primers. Here it is
>reverse complement
TTACCAGCGGGGTGTGATATGACCTAAGGTCCCGAACTCCTTCGAGAATACTTGGCTTAC
TGGAAAGAAGGCGCATCATAGACACCACTTCATCAGGGTAGTGTGTCTATATGTGTTGCC
TTATTACCAGAAGCATAAAAGCAGCATTTAGACCTGGTCATAAAGCCCCTGAGATGATTA
GCCTTATAGTCAGCTTTTTTACTGTAGCCATGTGTAGCTAAGGCCCCCTCCCTTTTCCAG
ACACAGAAGACACAAACAAAGAACTTCAGATTTTAACACA


I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.

Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.

#3 aazmaish

    member

  • Active Members
  • Pip
  • 8 posts

Posted 13 January 2012 - 02:05 AM

View Postpcrman, on 12 January 2012 - 08:19 PM, said:

You can use the reverse-complementary sequence to design cloning primers. Here it is
>reverse complement
TTACCAGCGGGGTGTGATATGACCTAAGGTCCCGAACTCCTTCGAGAATACTTGGCTTAC
TGGAAAGAAGGCGCATCATAGACACCACTTCATCAGGGTAGTGTGTCTATATGTGTTGCC
TTATTACCAGAAGCATAAAAGCAGCATTTAGACCTGGTCATAAAGCCCCTGAGATGATTA
GCCTTATAGTCAGCTTTTTTACTGTAGCCATGTGTAGCTAAGGCCCCCTCCCTTTTCCAG
ACACAGAAGACACAAACAAAGAACTTCAGATTTTAACACA


I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.

Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.


Thank you very much for helping me.
I have a Lenti vector into which i shall clone it. It has a XhoI site at position 4843 bp and a Xbal site at position 4852 bp. I want to clone this miRNA coding region between these two site. I am confused which enzyme site will go for forward primer and which would go for reverse. (I wonder if you design a primer from this sequence then it would be great help, and i can use that information for designing primers for my other miRNA coding region.)
Again thanks.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.