Hi,
I am very new to miRNA field. My supervisor said me to design primers for a miRNA located on minus strand of the genome. That miRNA is located in noncoding region of the genome.
I need help in designing primers. For example following is the sequence of the plus strand. what could be the primers of this sequence which could give a PCR product which i can clone in a lenti vector, and can get miRNA expression.
5' TGTGTTAAAATCTGAAGTTCTTTGTTTGTGTCTTCTGTGTCTGGAAAAGGGAGGGGGCCTTAGCTACACA
TGGCTACAGTAAAAAAGCTGACTATAAGGCTAATCATCTCAGGGGCTTTATGACCAGGTCTAAATGCTGC
TTTTATGCTTCTGGTAATAAGGCAACACATATAGACACACTACCCTGATGAAGTGGTGTCTATGATGCGC
CTTCTTTCCAGTAAGCCAAGTATTCTCGAAGGAGTTCGGGACCTTAGGTCATATCACACCCCGCTGGTAA 3'
Please help, and thanks in advance.
Designing primers for miRNA located on minus strand.
Started by aazmaish, Jan 12 2012 01:49 PM
miRNA Primers antisense
2 replies to this topic
#1
Posted 12 January 2012 - 01:49 PM
#2
Posted 12 January 2012 - 08:19 PM
You can use the reverse-complementary sequence to design cloning primers. Here it is
I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.
Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.
>reverse complement TTACCAGCGGGGTGTGATATGACCTAAGGTCCCGAACTCCTTCGAGAATACTTGGCTTAC TGGAAAGAAGGCGCATCATAGACACCACTTCATCAGGGTAGTGTGTCTATATGTGTTGCC TTATTACCAGAAGCATAAAAGCAGCATTTAGACCTGGTCATAAAGCCCCTGAGATGATTA GCCTTATAGTCAGCTTTTTTACTGTAGCCATGTGTAGCTAAGGCCCCCTCCCTTTTCCAG ACACAGAAGACACAAACAAAGAACTTCAGATTTTAACACA
I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.
Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.
#3
Posted 13 January 2012 - 02:05 AM
pcrman, on 12 January 2012 - 08:19 PM, said:
You can use the reverse-complementary sequence to design cloning primers. Here it is
I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.
Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.
>reverse complement TTACCAGCGGGGTGTGATATGACCTAAGGTCCCGAACTCCTTCGAGAATACTTGGCTTAC TGGAAAGAAGGCGCATCATAGACACCACTTCATCAGGGTAGTGTGTCTATATGTGTTGCC TTATTACCAGAAGCATAAAAGCAGCATTTAGACCTGGTCATAAAGCCCCTGAGATGATTA GCCTTATAGTCAGCTTTTTTACTGTAGCCATGTGTAGCTAAGGCCCCCTCCCTTTTCCAG ACACAGAAGACACAAACAAAGAACTTCAGATTTTAACACA
I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.
Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.
Thank you very much for helping me.
I have a Lenti vector into which i shall clone it. It has a XhoI site at position 4843 bp and a Xbal site at position 4852 bp. I want to clone this miRNA coding region between these two site. I am confused which enzyme site will go for forward primer and which would go for reverse. (I wonder if you design a primer from this sequence then it would be great help, and i can use that information for designing primers for my other miRNA coding region.)
Again thanks.













