Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Promoter design discussions

Promoter expression e. coli vector

  • Please log in to reply
No replies to this topic

#1 jimmah

jimmah

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 08 November 2011 - 08:13 PM

Hi,

I'm designing a new E. coli expression vector at the moment. Does anyone know whether there is a real practical difference (i.e. in transcription levels) between the native T5 promoter and the non-proprietary modified T5 promoter used in the pJexpress vector from DNA 2.0?

FYI:
>T5 promoter


AAATCATAAAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATAGATTC
>pJexpress T5 promoter
AAATCATGAAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATA

Cheers

James





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.