Google Sign in options
Remember me
This is not recommended for shared computers

Sign in anonymously
Don't add me to the active users list

Privacy Policy
Sign In
Create Account

Javascript Disabled Detected

You currently have javascript disabled. Several functions may not work. Please re-enable javascript to access full functionality.

Promoter design discussions

Started by jimmah, Nov 08 2011 08:13 PM

Promoter expression e. coli vector

Please log in to reply

No replies to this topic

#1 jimmah

member

Members
1 posts

0
Neutral

Posted 08 November 2011 - 08:13 PM

Hi,

I'm designing a new E. coli expression vector at the moment. Does anyone know whether there is a real practical difference (i.e. in transcription levels) between the native T5 promoter and the non-proprietary modified T5 promoter used in the pJexpress vector from DNA 2.0?

FYI:
>T5 promoter

AAATCATAAAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATAGATTC
>pJexpress T5 promoter
AAATCATGAAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATA

Cheers

James

Back to Molecular Biology · Next Unread Topic →

Also tagged with one or more of these keywords: Promoter, expression, e. coli, vector

Protocols and Techniques Forums → Molecular Biology → P1 transduction: What will happen if more than 2 FRT sequences exist Started by Guest_Qundo12_* , 03 Apr 2013 P1 transduction, E. coli and 2 more...	0 replies 221 views	Qundo12 03 Apr 2013
Protocols and Techniques Forums → Molecular Cloning → Restriction site rearrangement Started by Guest_relevant_username_* , 26 Mar 2013 cloning, restriction site and 2 more...	1 reply 116 views	phage434 26 Mar 2013
Protocols and Techniques Forums → Protein Expression and Purification → How to improve enzyme activity? Started by Guest_aodonnell311_* , 19 Mar 2013 enzymes, assays, substrates and 2 more...	2 replies 273 views	aodonnell311 30 Mar 2013
Protocols and Techniques Forums → Tissue and Cell Culture → Ric3 NAChR 7 expression in HEK cells Started by Guest_wasabi_* , 07 Mar 2013 HEK, expression	1 reply 196 views	yer_maw 24 Apr 2013
Protocols and Techniques Forums → Molecular Cloning → Vector insert ratio in cloning Started by Guest_harry348_* , 07 Mar 2013 vector, insert, ratio	3 replies 194 views	harry348 07 Mar 2013