Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

double digestion to figure out insert orientation problem!


  • Please log in to reply
No replies to this topic

#1 Fluffy

Fluffy

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 76 posts
2
Neutral

Posted 03 November 2011 - 06:25 PM

Hello Everyone,
I have two problems that I need an explanation for please!

I did ligation reactions with different insert: vector ratios (3:1, 4:1, and 6:1), and two control reactions control 1: no insert of interest and control 2: no ligase enzyme. I transformed the reactions into Bl21 bacterial cells and plated into ampicillin LBA medium.
My first problem is that control 1 (has no insert, but has linearized pET14b vector by double digestion using NdeI and XhoI) had a high number of colonies. Theoretically, it is not suppose to have colonies. What is the problem?
My three ligation reactions show high number of colonies. Control 2 shows no colonies at all which makes sense since ligation did not occur.

My other problem is: I did plasmid miniprep for my three ligations, and control 1. I double digested using PstI to confirm that orientation of insert is correct. My reasons for using Pst I for double digestion is that it cuts at the vector pET14b and at one of the ends of my insert. To make it clearer, I think it would be good to google the pET14b vector to see exactly where PstI cuts in the vector.
Below is my insert sequence and PstI cuts at 41. I used React buffer 2.
  atgg cgtcgaagaggatattgaag gagctcaagg atctgcagaa ggatcccccc acatcatgca gtgctggtcc
  agtggcagag gatatgttcc attggcaagc aacaatcatg gggcctaccg atagccctta
  tgctggaggt gtatttttgg tttcaattca tttccctcca gattatcctt ttaagcctcc
  aaaggttgcc ttcagaacta aggttttcca tcccaacatc aacagcaatg gaagtatttg
tctggatatt cttaaggagc agtggagtcc agcattaacc atatccaagg tcctgctgtc
  catctgctct ctgttgacag acccaaaccc agatgatcct cttgtacctg aaattgctca
  catgtacaag actgacaggg ccaaatacga aaccactgct cgtagctgga ctcagaaata tgcaatggga tga

I ran a gel of my digestion, and thinking that I should get a smaller band, and a larger band. But my result is nothing similar as you can see in the image attached. Based on the 1KB ladder, all bands are above 3000bp. What can you guys deduce from the gel image about my results, what is wrong?
In the gel image my samples are the last 4 from the right side (from right, ligation 6:1, ligation 4:1, ligation 3:1, and control 1) Oct31-2011 orientation check.jpg
Please help me with this!!
Thanks,
fluffy

Edited by Fluffy, 03 November 2011 - 06:27 PM.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.