6 replies to this topic

[Curtis]

I have a primer which has 4 nt overhang sequence, 6 nt RE sequence and a TATAGGG sequence just before the binding sequence of the gene of interest:

CAGA CGTCTC G TATAGGG ACCAAACAGAGAATCTGTGAG
--------------------------------------


so the non-binding sequence is 18 nucleotides, compared to the 21 nucleotide binding sequence.

Will this PCR work? how long the non-binding sequence can be to not affect the binding ability of the binding sequence?

Edited by Curtis, 27 October 2011 - 07:58 PM.

[Papaver]

I've been running PCR with Primers that had 26 binding-nt and 27 non-binding nt. And it worked well. However I had 10 nt at 5' and 16 nt at 3' end that matched which means the non-binding part was like a loop inbetween.

But I think you can try and run the PCR. I guess it might depend on the annealing temperature of the primer part that binds.

[phage434]

There's no reason to think this should not work.  Are you having trouble?

[Curtis]

yes phage434, actually I am. however the Tm between my primers is also above 5C, so I'm not sure if the problem is because of the Tm difference or the Forward primer's non-binding site.

[phage434]

What is  your second primer?  What are your cycling conditions and reaction mix?

[Curtis]

phage434, on 29 October 2011 - 08:50 AM, said:

What is  your second primer?  What are your cycling conditions and reaction mix?

I'm still dealing with the same full-length assembly of a virus genome. I hope you remember my older posts that you also replied to them.
here's the link

http://www.protocol-...__fromsearch__1

I have got PCRs to work with primers with higher than 5C Tm difference, but this one is really annoying me.

[Papaver]

Have you tried a gradient PCR for optimizing your annealing temperature. In the other post you wrote you use Pfu with extension time 2kb/min. Is it really that high. Whenever I used Pfu I run 30sec/min. Maybe another polymerase would be better. Phusion is a good one...
Is your template good and does it differ from you usual PCR stuff? Do you run a positive control to be sure that general conditions are ok?