Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Length of non-binding sequence in primers with RE site


  • Please log in to reply
6 replies to this topic

#1 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,112 posts
59
Excellent

Posted 27 October 2011 - 07:55 PM

I have a primer which has 4 nt overhang sequence, 6 nt RE sequence and a TATAGGG sequence just before the binding sequence of the gene of interest:

CAGA CGTCTC G TATAGGG ACCAAACAGAGAATCTGTGAG
--------------------------------------


so the non-binding sequence is 18 nucleotides, compared to the 21 nucleotide binding sequence.

Will this PCR work? how long the non-binding sequence can be to not affect the binding ability of the binding sequence?

Edited by Curtis, 27 October 2011 - 07:58 PM.


#2 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 27 October 2011 - 11:56 PM

I've been running PCR with Primers that had 26 binding-nt and 27 non-binding nt. And it worked well. However I had 10 nt at 5' and 16 nt at 3' end that matched which means the non-binding part was like a loop inbetween.

But I think you can try and run the PCR. I guess it might depend on the annealing temperature of the primer part that binds.

#3 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,501 posts
252
Excellent

Posted 28 October 2011 - 03:40 AM

There's no reason to think this should not work. Are you having trouble?

#4 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,112 posts
59
Excellent

Posted 28 October 2011 - 08:05 PM

yes phage434, actually I am. however the Tm between my primers is also above 5C, so I'm not sure if the problem is because of the Tm difference or the Forward primer's non-binding site.

#5 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,501 posts
252
Excellent

Posted 29 October 2011 - 08:50 AM

What is your second primer? What are your cycling conditions and reaction mix?

#6 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,112 posts
59
Excellent

Posted 29 October 2011 - 07:55 PM

What is your second primer? What are your cycling conditions and reaction mix?


I'm still dealing with the same full-length assembly of a virus genome. I hope you remember my older posts that you also replied to them.
here's the link

http://www.protocol-...__fromsearch__1

I have got PCRs to work with primers with higher than 5C Tm difference, but this one is really annoying me.

#7 Papaver

Papaver

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 77 posts
19
Good

Posted 31 October 2011 - 04:50 AM

Have you tried a gradient PCR for optimizing your annealing temperature. In the other post you wrote you use Pfu with extension time 2kb/min. Is it really that high. Whenever I used Pfu I run 30sec/min. Maybe another polymerase would be better. Phusion is a good one...
Is your template good and does it differ from you usual PCR stuff? Do you run a positive control to be sure that general conditions are ok?




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.