Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Standalone BLAST multiple query file - help

Standalone Blast query file

  • Please log in to reply
No replies to this topic

#1 Gwynneth

Gwynneth

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 26 October 2011 - 04:26 AM

Please can someone help.....I am trying to use Standalone BLAST. I have succesfully downloaded the BLAST program and created my own database of sequences. I have also created a fasta file with my query sequences
eg.
>name1
gggatcgatgcatgcatgca
>name2
gctgatcgtagctagttgtca
>name3
gtgtcagtcgataaactg

The command I entered is blastn -query QueryFile.fasta -db MYDATABASE -out BLASTout

I get a result file but the problem is that only the first of my quey sequences in the query file has been blasted. How do I get all of the sequences in my query file to be blasted against my database? Any suggestions would be greatly appreciated. Thanx!




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.