No replies to this topic

[Gwynneth]

Please can someone help.....I am trying to use Standalone BLAST.  I have succesfully downloaded the BLAST program and created my own database of sequences.  I have also created a fasta file with my query sequences
eg.  
>name1
gggatcgatgcatgcatgca
>name2
gctgatcgtagctagttgtca
>name3
gtgtcagtcgataaactg

The command I entered is blastn -query QueryFile.fasta -db MYDATABASE -out BLASTout

I get a result file but the problem is that only the first of my quey sequences in the query file has been blasted. How do I get all of the sequences in my query file to be blasted against my database?  Any suggestions would be greatly appreciated.   Thanx!