Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

How do I find the promoter of a gene?

promoter gene

  • Please log in to reply
3 replies to this topic

#1 andyg2886

andyg2886

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 23 October 2011 - 11:14 AM

Hi

I have the gDNA of a gene. It's 32,518bp long.

The ATG start site begins at position 329bp.

Is it possible to find the sequence of the promoter?

Thanks

#2 pDNA

pDNA

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 493 posts
14
Good

Posted 28 October 2011 - 10:02 AM

yes it is!
eukaryotic or prokaryotic system?

Regards,
p

#3 andyg2886

andyg2886

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 28 October 2011 - 10:51 AM

Eukaryotic... It's the human EWSR1 gene.

#4 pDNA

pDNA

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 493 posts
14
Good

Posted 28 October 2011 - 11:32 AM

i'm no specialist on eukaryotic genomics (i'm overwhelmed by the complexitiy of prokaryotes ...i do not need a nucleus to get messed up everyday!)
...but there are prediction algorithems available to predict eukaryotic promoters e.g.:
http://molbiol-tools.ca/Promoters.htm
or
http://rulai.cshl.ed...l?species=Human

the laterone lets you e.g. extract promoter sequences of genes based on the accession number.
This is what i found for EWSR1:
>NM_005243-Human-1 EP73961 chr22 + 27988154 27989154 hchr22_00279
aaagggcctgctccacctcgaccgttaccggggatagggtctcggggccaggcacggcgttcgaggcctcccacccagcc
gaccggccttggggacccttccccgctggcccgggccacgcgtcccgggtactcactgcagagcgcgcccggcaaccccg
aaaggccggtcggggaccccggctgggagtcaggactctagctcccgggcgcgacccgagaaccctgaatccattccgcg
cacacccggccgcgtgacccctgccgaccggctggcgcgccacccattccccgcggcccgcggattagtcagcagttgtt
ctagtccgggtcccttcccccagccctcccgccgatctccgtctccctgcagggccgactcttcagcgaccgtccctaga
gccagcggacggaaccattccaaacagcctagtctcgtgctgagagcctctccggtttcacgctgagacccgctcacccc
cgctctggccccttagatgctattttggcccgagtgtcacgtcgggcgctctttagagaggactgggacaagagttgcgg
acgcgaagaacgagtaagcggtggttcatccctcctgaccccacccccgtggcctggcccgatggtcgcgcccggggttg
cgagatttgcgcctgcgcagtgcggcgcctagagggaaagcgagagggagacggacgttgAGAGAACGAGGAGGAAGGAG
AGAAAATGGCGTCCACGGGTGAGTATGGTGGAACTGCGGTCGCGCCGGCGGTAGCCGGAACGCCCAAACTGGGGGTCGTT
CGTCTCTGGGCTTGGCTGGGAAGACTGAGTGGAGTTGCCGAGAGGGGGTTGAGGCACCCGCCGCGGCCCGACGAGCTCGG
GGATCCGCATTCCTCTCCCCTCCCCCAACCGGGCGGGCCGGTTCTGGAATCTTCCGGCGCCCGTGGCGCGCGGGGGGCTT
GCTGCGGCGGGGGCGCGCGGGGCCCGCCTTGGCCTCCATT

base pairs in the upstream region of transcript start site are in lower cases while those in the downstream are in capital cases.

Regards,
p






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.