1 reply to this topic

[Lee Zelaya]

I'm  are trying to insert the DNA sequence below into the multiple cloning site of a plasmid that has been digested with BamHI (cuts 5’GGATCC3’) and EcoRI (cuts 5’GAATTC3’). Design PCR primers to amplify the sequence highlighted below, and incorporate the appropriate restriction sites. Assume that a 6-nucleotide long sequence will be sufficient for high specificity amplification (in reality, at least 15 nucleotides are required).                                            


5’-5'GATTACGGTAAATGCCGGATTAACCCGGGTTATCAGGCCACGTACAACTGGAGTCC-3’
3’-3'CTAATGCCATTTACGGCCTAATTGGGCCCAATAGTCCGGTGCATGTTGACCTCAGG-5’

[sks1]

u sud also add at least 3-5 more basepairs to 5' end before RE site so that Restriction Enzyme can sit properly over DNA and cut it efficiently..

gd luck