Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

How do I insert a DNA sequence into a multiple cloning site and add restriction

Help plese

  • Please log in to reply
1 reply to this topic

#1 Lee Zelaya

Lee Zelaya

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 17 October 2011 - 06:42 PM

I'm  are trying to insert the DNA sequence below into the multiple cloning site of a plasmid that has been digested with BamHI (cuts 5’GGATCC3’) and EcoRI (cuts 5’GAATTC3’). Design PCR primers to amplify the sequence highlighted below, and incorporate the appropriate restriction sites. Assume that a 6-nucleotide long sequence will be sufficient for high specificity amplification (in reality, at least 15 nucleotides are required).                                            


5’-5'GATTACGGTAAATGCCGGATTAACCCGGGTTATCAGGCCACGTACAACTGGAGTCC-3’
3’-3'CTAATGCCATTTACGGCCTAATTGGGCCCAATAGTCCGGTGCATGTTGACCTCAGG-5’

#2 sks1

sks1

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 21 October 2011 - 05:34 AM

u sud also add at least 3-5 more basepairs to 5' end before RE site so that Restriction Enzyme can sit properly over DNA and cut it efficiently..

gd luck




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.