Jump to content


- - - - -

methylation analysis with MS-HRM (primer design)


1 reply to this topic

#1 lmg

    member

  • Active Members
  • Pip
  • 9 posts

Posted 14 October 2011 - 02:03 AM

I have a question,

I am studying promotor methylation. Some primers I have ordered do not work (MS-HRM with Rotor-GeneQ).
As I am reading Wojdacz and his recommendations for primer design I don't understand one thing -

he is recommending that in primer sequence there should be at least on C (the one from CpG, potentially methylated) included at 5´ end of the primer, to ensure amplification of both methylated and un-methylated sequence. Still - does this have to be a wobble base C/T (when ordering this should be Y) or not?

Example from his article: Reversal of PCR bias for improved sensitivity of the DNA methylation melting curve assay, BioTechniques, 2006: Forward primer sequence: TCGGAGGGGTGTAGATAGAGT - so no wobble base. Wouldn't this primer extend only methylated sequence?

Bit confusing for me, I would appreciate help,

thank you,

lmg

#2 methylnick

    Veteran

  • Moderator
  • PipPipPipPipPip
  • 250 posts

Posted 26 October 2011 - 07:41 PM

Img, the most sequence discriminatory region of your primer is the 3' end. as long as it ends in one more more conversion events (T's that were C's prior to bisulphite conversion) you are okay, it will still amplify both templates.

As for the C at the 5' end, I think it works two ways, in some ways it stabilises the primer during hybridisation in the PCR step and another is that you have four bases incorporated into the sequence during primer synthesis.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.