I am unable to perform a PCR reaction for SR-A (scavenger receptor transcript variants). My reaction details are provided below with modifications I've made. Please help.
Forward-Primer 5’-GTA AAGCTT ACC ATGACAAAAGAGATGACAGAG-3’
Addtnl sequence for RE (Hind III) (Kozak)
Reverse-Primer 5’-TCGT CTCGAG TTATACTGATCTTGATCCGCC-3’
(Xho)
These are the sequences of forward and reverse primers for SR-A transcript variant II.
In a reaction volume of 50 micro L , we use 0.4 micro-gram of cDNA, 1 micro L of DNTP mix(10 mM each), 100 pico-mole of each primer (1 micro L each), 5 micro L of 10X buffer and 1 micro L of enzyme( all the reagents from NEB, e.g. Taq DNA polymerase and supplied buffer). The reaction condition is
98 deg(3 mins.), 40cycles of [98 deg 30s/ 52 deg 30s/72 deg 1min 30s], then 72 deg 10 mins, 4 deg.
I did not get any PCR. I have varied the annealing temp but to no avail. I have used even phusion enzyme with different annealing temperatures, but either I've got non-specific bands or no band at all.For your convenience I am submitting the mRNA sequence (1065 nt) of the gene.
atgacaaaagagatgacagagaatcagaggctctgccctcatgaacaagaggatgctgactgcagttcagaatccgtgaaatttgacgcacgttcaatgacagcatcccttcctcacagcactaaaaatggcccctcccttcaggagaagttgaagtccttcaaggctgccctcattgctctctacctccttgtgtttgcagtactaatacctgttgttggaatagtaacagctcagcttttgaattgggaaatgaagaactgcttagtttgttcacttaacacaagtgacacatctcaaggtcctatggaaaaagaaaataccagtaaagtggaaatgagatttacaattatcatggaacacatgaaggacatggaggagagaatcgaaagcatttcaaactcaaaagccgaccttatagacacggaacgcttccagaatttcagcatggcaactgaccaaagacttaatgatattcttctgcagttaaattccttgatttcgtcagtccaggaacatgggaattcactggatgcaatctccaagtccttgcagagtctgaatatgacactgcttgatgttcaactccatacagaaacactgaatgtcagagtccgtgaatctacagcaaagcaacaggaggacatcagtaaattggaggaacgtgtgtacaaagtatcagcagaagtccagtctgtgaaagaagaacaagcgcacgtggaacaggaagtaaaacaggaagtgagagtattgaacaacatcaccaacgacctcagactgaaggactgggaacactcacagacactgaaaaacatcaccttcattcaagggcctcctggaccccaaggtgaaaagggagacagagggcttactggacaaactggtccacctggtgctccaggaataagaggtattccaggtgttaaaggtgatcggggacaaattggcttccctggaggtcgaggaaacccaggagcaccaggaaagccagggaggtcgggatctcctggacctaaaggacaaaagggagagaaggggagtgtaggcggatcaagatcagtataa
I am at my wit's end. I'm having the same problem with SR-A I but not going into that right now. May be u can help me with this and subsequently I'll be able to troubleshoot the other one.
3 replies to this topic
#1
Posted 03 October 2011 - 12:09 AM
#2
Posted 03 October 2011 - 04:34 AM
In my opinion i would say the melting temperature of ur primers are bit low (49.9 and 51.8 as per oligonalizer)...., so it s difficult to get a specific amplification for this temp....anyhow other than this you also got to make sure there s enough starting template (which depends on the expression of ur GOI). if there s much you have room to reduce the cDNA conc. may be others here might give you more suggestions....
I would prefer being perfectionist rather than a passionist in Research.
I always had an alternate hypothesis....
I always had an alternate hypothesis....
#3
Posted 03 October 2011 - 04:50 AM
I would check that my template cDNA was good by trying to amplify another gene. Although those cycling conditions look as if they might work for Phusion, they will not work for Taq or many other enzymes. Taq will be degraded at 98. Your reverse primer has a very high GC content at the 3' end, which may cause non-specific priming. You are likely adding too much primer (100 pmol vs. recommended 25 pmol). You could try adding 3-6% DMSO, but my first recommendation would be to redesign the primers, probably by adding a few bases at the 3' end. High marks for providing lots of information to us.
#4
Posted 06 October 2011 - 09:45 PM
It looks that I have overcome the problem. Thanks for your suggestions, thank you so much.
@Moderator- I was wrong when I said 98*C for Taq, it was actually 94*C.
@Moderator- I was wrong when I said 98*C for Taq, it was actually 94*C.
Also tagged with one or more of these keywords: PCR, SR-A
![]() |
Protocols and Techniques Forums →
Tissue and Cell Culture →
Housekeeper for HEK cells?Started by Guest_Stephp_* , 17 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
Molecular Cloning →
Cloning large fragmentsStarted by Guest_bknm_* , 15 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
Can't get PCR with large overhang primers to workStarted by Guest_EtOH_* , 10 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
Primer Efficiency across runsStarted by Guest_Joe101_* , 08 May 2013 |
|
|
|
![]() |
Protocols and Techniques Forums →
PCR, RT-PCR and Real-Time PCR →
|
|
|














