Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Unable to PCR!!!!

PCR SR-A

  • Please log in to reply
3 replies to this topic

#1 writoban

writoban

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 03 October 2011 - 12:09 AM

I am unable to perform a PCR reaction for SR-A (scavenger receptor transcript variants). My reaction details are provided below with modifications I've made. Please help.


Forward-Primer 5’-GTA AAGCTT ACC ATGACAAAAGAGATGACAGAG-3’

Addtnl sequence for RE (Hind III) (Kozak)


Reverse-Primer 5’-TCGT CTCGAG TTATACTGATCTTGATCCGCC-3’
(Xho)

These are the sequences of forward and reverse primers for SR-A transcript variant II.
In a reaction volume of 50 micro L , we use 0.4 micro-gram of cDNA, 1 micro L of DNTP mix(10 mM each), 100 pico-mole of each primer (1 micro L each), 5 micro L of 10X buffer and 1 micro L of enzyme( all the reagents from NEB, e.g. Taq DNA polymerase and supplied buffer). The reaction condition is

98 deg(3 mins.), 40cycles of [98 deg 30s/ 52 deg 30s/72 deg 1min 30s], then 72 deg 10 mins, 4 deg.

I did not get any PCR. I have varied the annealing temp but to no avail. I have used even phusion enzyme with different annealing temperatures, but either I've got non-specific bands or no band at all.For your convenience I am submitting the mRNA sequence (1065 nt) of the gene.

atgacaaaagagatgacagagaatcagaggctctgccctcatgaacaagaggatgctgactgcagttcagaatccgtgaaatttgacgcacgttcaatgacagcatcccttcctcacagcactaaaaatggcccctcccttcaggagaagttgaagtccttcaaggctgccctcattgctctctacctccttgtgtttgcagtactaatacctgttgttggaatagtaacagctcagcttttgaattgggaaatgaagaactgcttagtttgttcacttaacacaagtgacacatctcaaggtcctatggaaaaagaaaataccagtaaagtggaaatgagatttacaattatcatggaacacatgaaggacatggaggagagaatcgaaagcatttcaaactcaaaagccgaccttatagacacggaacgcttccagaatttcagcatggcaactgaccaaagacttaatgatattcttctgcagttaaattccttgatttcgtcagtccaggaacatgggaattcactggatgcaatctccaagtccttgcagagtctgaatatgacactgcttgatgttcaactccatacagaaacactgaatgtcagagtccgtgaatctacagcaaagcaacaggaggacatcagtaaattggaggaacgtgtgtacaaagtatcagcagaagtccagtctgtgaaagaagaacaagcgcacgtggaacaggaagtaaaacaggaagtgagagtattgaacaacatcaccaacgacctcagactgaaggactgggaacactcacagacactgaaaaacatcaccttcattcaagggcctcctggaccccaaggtgaaaagggagacagagggcttactggacaaactggtccacctggtgctccaggaataagaggtattccaggtgttaaaggtgatcggggacaaattggcttccctggaggtcgaggaaacccaggagcaccaggaaagccagggaggtcgggatctcctggacctaaaggacaaaagggagagaaggggagtgtaggcggatcaagatcagtataa

I am at my wit's end. I'm having the same problem with SR-A I but not going into that right now. May be u can help me with this and subsequently I'll be able to troubleshoot the other one.

#2 GNANA

GNANA

    GNANA

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 209 posts
9
Neutral

Posted 03 October 2011 - 04:34 AM

In my opinion i would say the melting temperature of ur primers are bit low (49.9 and 51.8 as per oligonalizer)...., so it s difficult to get a specific amplification for this temp....anyhow other than this you also got to make sure there s enough starting template (which depends on the expression of ur GOI). if there s much you have room to reduce the cDNA conc. may be others here might give you more suggestions....
I would prefer being perfectionist rather than a passionist in Research.

I always had an alternate hypothesis....

#3 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,484 posts
251
Excellent

Posted 03 October 2011 - 04:50 AM

I would check that my template cDNA was good by trying to amplify another gene. Although those cycling conditions look as if they might work for Phusion, they will not work for Taq or many other enzymes. Taq will be degraded at 98. Your reverse primer has a very high GC content at the 3' end, which may cause non-specific priming. You are likely adding too much primer (100 pmol vs. recommended 25 pmol). You could try adding 3-6% DMSO, but my first recommendation would be to redesign the primers, probably by adding a few bases at the 3' end. High marks for providing lots of information to us.

#4 writoban

writoban

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 06 October 2011 - 09:45 PM

It looks that I have overcome the problem. Thanks for your suggestions, thank you so much.
@Moderator- I was wrong when I said 98*C for Taq, it was actually 94*C.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.