Hello all,
I am a new TA and people in my lab are either too busy or unwilling to help. I need to design some primers and I was wondering if i am doing this right.
I will be using two different enzyme so I can add ''direction'' to my PCR product. That way I will make sure that the insert end up in the direction I need. I need to amplify the promoter of dacC in E. coli.
These are my primers:
5' AAAAGAATTCGCCAGATAGCGGA 3' EcoRI
Len: 23
MW: 7114.59
Tm: 68.36° C
GC: 43.48%
Sec. Str.: Moderate
Primer Dimer: No
5' AAAGGATCCTGGCGTAATCCATTA 3' BamH
Len: 24
MW: 7360.69
Tm: 66.96° C
GC: 41.67%
Sec. Str.: Moderate
Primer Dimer: No
Do you think they will work? suggestions??
Thanks!
Help designing primers with restriction sites
Started by Ladymarge, Oct 01 2011 02:33 PM
3 replies to this topic
#1
Posted 01 October 2011 - 02:33 PM
#2
Posted 01 October 2011 - 02:36 PM
The first primer is the forward one and the second one the reverse.
#3
Posted 01 October 2011 - 03:36 PM
I think the primer region binding to your template is too short. That is what determines the Tm for early cycles, so it needs to be longer. You have only 13 bases, while a typical good primer is 18-22 bases long in the template binding region.
Also, given a choice, I would not choose BamHI as an enzyme, since it cannot be heat killed.
Also, given a choice, I would not choose BamHI as an enzyme, since it cannot be heat killed.
#4
Posted 03 October 2011 - 09:16 AM
First of all think twice about staying in a lab that is unwilling to help.
Second, your primers might work since E. coli genome is not very complex, but the ecori primer may be a bit GC rich (try to keep it about 50%) and the bamhi reverse is too AT rich - its best to have the 3' end of the primer end with a GC clamp.
did you use a program to design or just eyeball?
Second, your primers might work since E. coli genome is not very complex, but the ecori primer may be a bit GC rich (try to keep it about 50%) and the bamhi reverse is too AT rich - its best to have the 3' end of the primer end with a GC clamp.
did you use a program to design or just eyeball?













