Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Why primers shouldn't have Tm difference greater than 5°C?


  • Please log in to reply
5 replies to this topic

#1 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 981 posts
45
Excellent

Posted 29 September 2011 - 01:57 AM

Tm for my forward primers is 73C and for the reverse is 53C.

Primer F
TGCAGGCGCCCCGAGTGCTGC

Primer R
CGTCACTAGTGTCGTCTACTA

Apart from the fact that Tm 73C is even higher than the extension temperature (68C for pfx DNA polymerase), the Tm calculators tell me the difference between the Tm temperatures is greater than the recommended 5C and therefore the PCR won't work.

Why?

#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 950 posts
67
Excellent

Posted 29 September 2011 - 05:08 AM

Tm tels you at which temperature you will have half of your primer melted (i.e. not binding template DNA). Ta is choosed to be lower than Tm so most of your primers bind the DNA. The lower you go with the temperature the chance grows that your primer would bind unspecifically (to non-complementary sequence). So you have to choose right annealing temperature, not so high (no amplification) not so low (nonspecific).
If you have primers with such different Tm, you can't have optimal temperature for both primers to bind.
IMO.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#3 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 981 posts
45
Excellent

Posted 29 September 2011 - 06:25 AM

But is there any chance it might work?

#4 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 950 posts
67
Excellent

Posted 29 September 2011 - 08:08 AM

There is always chance. They are many ways to calculate Tm and some of them differ a lot. And the real situation depends on the template too and who knows what else.
But I wouldn't be too optimistic, its 20 degrees. Your F primer sequence is high self-complementary so you would need higher Ta to relax it, but at that time your R primer wouldn't be probably binding the DNA at all.
You can try it, but if it doesn't work, it would be probably quicker and cheaper to design new primers.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#5 allynspear

allynspear

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 83 posts
9
Neutral

Posted 29 September 2011 - 12:38 PM

I understand the point that Trof is trying to make, and I agree that if the PCR doesn't work and you have the option, I would try to redesign different primers that had closer Tm values.  For example, you could take the last "GC" off your forward primer and that would drop your Tm by about 8 degrees.  That being said, I have had situations where I had no choice in using two primers with widely different Tm values and gotten the PCR to work fine.  You always need to work within the confines of your lowest Tm primer, meaning you will probably need to use an annealing temperature of 50-54 degrees.  In addition, I have found that working with high Tm primers means you may want to extend your denaturation step.  Most polymerases come with a recommended time range (e.g. 95 degrees for 10-30 s).  If I have a primer with a Tm over 65, I usually extend my denaturation step in the cycling to 30 degrees and I find that it does help.

Best of Luck.

#6 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 981 posts
45
Excellent

Posted 06 October 2011 - 11:00 PM

The gradient PCR failed. I set the temps from 40C to 65C but it didn't produce any band. I also ran a 2 step PCR, I played with the denaturation time as recommended by allynspear but it also failed. I think I'm gonna design new primers.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.