Jump to content


- - - - -

Tm calculation for primers with RE sites and overhangs


4 replies to this topic

#1 Curtis

    Metaller Scientist

  • Active Members
  • PipPipPipPipPip
  • 566 posts

Posted 18 September 2011 - 08:42 PM

Hi,

I always wonder do we have to calculate the Tm for the whole primer, or only for the sequence complementary to the gene of interest? the TM for the blue regions are 50 and 64C respectively, but for the whole primer are 67 and 72C.



P1-BsmBI:

CAGACGTCTCGTATAGGGACCAAACAGAGAATCTGTGAG (TATA and GGG are introduced)

P2-PmlI

CTTGCACGTGTGCAGCACTCGGGGCGCCTGC
Expected size: 3700 b

My PCR doesn't work. I use pfu.

Edited by Curtis, 18 September 2011 - 08:43 PM.


#2 leelee

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 414 posts

Posted 18 September 2011 - 09:44 PM

Only the complementary sequence, as the Tm has to do with only the binding component.

What are your PCR conditions? 3500bp is quite a large product, do you have a long enough extension time?

#3 Curtis

    Metaller Scientist

  • Active Members
  • PipPipPipPipPip
  • 566 posts

Posted 19 September 2011 - 12:51 AM

Thanks Leelee.

According to the manual, the extension time should be 2min/kb. So I had my extension for 8 min. Should be enough.

So I shouldn't worry about the Tm of the whole primer.hm....I had my annealing Temp at 45C

#4 Trof

    Brain on a stick

  • Active Members
  • PipPipPipPipPip
  • 577 posts

Posted 19 September 2011 - 01:44 AM

Primer3+ says your first primer (the complementary part) has Tm 45 and the second 78 and both have high self-complementarity on 3' ends. So you have high dimer probability, huge difference in Tm and low Ta (there may be secondary structures in DNA that prevent amplification).
I would recommend primer redesign and higher Ta (or play with DMSO).
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

#5 Curtis

    Metaller Scientist

  • Active Members
  • PipPipPipPipPip
  • 566 posts

Posted 19 September 2011 - 04:36 AM

I think I'm gonna go with DMSO, I can't afford re-synthesizing the primers.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.