Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Tm calculation for primers with RE sites and overhangs


  • Please log in to reply
4 replies to this topic

#1 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,112 posts
58
Excellent

Posted 18 September 2011 - 08:42 PM

Hi,

I always wonder do we have to calculate the Tm for the whole primer, or only for the sequence complementary to the gene of interest? the TM for the blue regions are 50 and 64C respectively, but for the whole primer are 67 and 72C.



P1-BsmBI:

CAGACGTCTCGTATAGGGACCAAACAGAGAATCTGTGAG (TATA and GGG are introduced)

P2-PmlI

CTTGCACGTGTGCAGCACTCGGGGCGCCTGC
Expected size: 3700 b

My PCR doesn't work. I use pfu.

Edited by Curtis, 18 September 2011 - 08:43 PM.


#2 leelee

leelee

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 652 posts
52
Excellent

Posted 18 September 2011 - 09:44 PM

Only the complementary sequence, as the Tm has to do with only the binding component.

What are your PCR conditions? 3500bp is quite a large product, do you have a long enough extension time?

#3 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,112 posts
58
Excellent

Posted 19 September 2011 - 12:51 AM

Thanks Leelee.

According to the manual, the extension time should be 2min/kb. So I had my extension for 8 min. Should be enough.

So I shouldn't worry about the Tm of the whole primer.hm....I had my annealing Temp at 45C

#4 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,153 posts
102
Excellent

Posted 19 September 2011 - 01:44 AM

Primer3+ says your first primer (the complementary part) has Tm 45 and the second 78 and both have high self-complementarity on 3' ends. So you have high dimer probability, huge difference in Tm and low Ta (there may be secondary structures in DNA that prevent amplification).
I would recommend primer redesign and higher Ta (or play with DMSO).

Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

'Normal' is a dryer setting. - Elizabeth Moon


#5 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,112 posts
58
Excellent

Posted 19 September 2011 - 04:36 AM

I think I'm gonna go with DMSO, I can't afford re-synthesizing the primers.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.