Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Gene on negative strand - two eductional questions.


  • Please log in to reply
3 replies to this topic

#1 Nephrite

Nephrite

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 66 posts
3
Neutral

Posted 04 July 2011 - 05:07 AM

Dear all,

I am designing some new primers for RT-PCR.

Some of the genes of interest are situated on the negative strand of gDNA.

When I faced this situation for first time I noted that the published mRNA was the same as the (-) gDNA.

Then, I designed my primers, as I am going to do it now as well, but I need to know something:

1. I thought that only the (+) strands are being published in NCBI, why there are also (-) strands?

2. I thought that the (-) strand is the one, which is being transcribed and is complementary to the resulting RNA.  If so, the (+) strand should be the same as the published RefSeq mRNA without the intron sequences, isn`t it?

What do I miss?

PS - I have one more question about the BLAST tool for primers specificity:

I loaded one mRNA sequence together with primers, which I designed in the past. These primers are tested for specificity by basic PCR and real time-PCR.

This is what I get:

Products on intended target
product length = 217
Forward primer  1    CTGGACTGTGGCATTGAGAC  20
Template        565  ....................  584

Reverse primer  1    TAACGCGAGTGAGAATGTGC  20
Template        781  ....................  762

Products on potentially unintended templates
product length = 202
Forward primer  1    CTGGACTGTGGCATTGAGAC  20
Template        665  ..TCC..........C....  684

Forward primer  1    CTGGACTGTGGCATTGAGAC  20
Template        866  G.......AA...C......  847

The dots should mean the complementary bases, right?

Answer on any of my questions would be highly appreciated.

Edited by Nephrit, 04 July 2011 - 07:05 AM.


#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 946 posts
66
Excellent

Posted 04 July 2011 - 07:44 AM

(+) and (-) are arbitrary denominations of DNA strands. Only direction that makes sense is the mRNA (or other functional RNAs, but that's virtually the same), that is single-stranded and translated to protein in the defined order. I would logically expect naming the gDNA strands with respect to that. So, (+) have the same sequence as mRNA (= coding strand), so the mRNA is created with (-) strand as a template. Problem now is in the fact that mRNAs can be in both directions, but of course whole strand on one chromosome must be either (+) or (-). Someone had to decide which one.
Historically, some gDNA was sequenced and published from one direction, the other one from other, presumably in respect for mRNA it creates. But after Human Genome Project was finished and aligned, all single gene gDNA entries were replaced by whole chromosome reads and as I wrote one strand must be always (+) and the other (-) even when (+) is not a coding strand for some of the mRNAs. This make some of the mRNAs to be from (-) strand.

This may aswer your first question, NCBI must have both strands in database (like for BLAST search) because each strand is the coding one for some mRNAs. I hope second question was also answered above.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#3 Nephrite

Nephrite

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 66 posts
3
Neutral

Posted 05 July 2011 - 03:43 AM

View PostTrof, on 04 July 2011 - 07:44 AM, said:

(+) and (-) are arbitrary denominations of DNA strands. Only direction that makes sense is the mRNA (or other functional RNAs, but that's virtually the same), that is single-stranded and translated to protein in the defined order. I would logically expect naming the gDNA strands with respect to that. So, (+) have the same sequence as mRNA (= coding strand), so the mRNA is created with (-) strand as a template. Problem now is in the fact that mRNAs can be in both directions, but of course whole strand on one chromosome must be either (+) or (-). Someone had to decide which one.
Historically, some gDNA was sequenced and published from one direction, the other one from other, presumably in respect for mRNA it creates. But after Human Genome Project was finished and aligned, all single gene gDNA entries were replaced by whole chromosome reads and as I wrote one strand must be always (+) and the other (-) even when (+) is not a coding strand for some of the mRNAs. This make some of the mRNAs to be from (-) strand.

This may aswer your first question, NCBI must have both strands in database (like for BLAST search) because each strand is the coding one for some mRNAs. I hope second question was also answered above.

Thank you, Trof! :-)

#4 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 946 posts
66
Excellent

Posted 06 July 2011 - 12:17 PM

And yes, dots are complementary.
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.