Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

No Amplification in PCR


  • Please log in to reply
4 replies to this topic

#1 renee

renee

    member

  • Members
  • Pip
  • 4 posts
1
Neutral

Posted 07 June 2011 - 08:17 AM

Hi All,

I have been trying to perform a PCR on my mini-prep but to no avail.

My desire sequence (S100B gene) is inside a pDONR223 vector. My mini-prep gave me a concentration of approximately 190 ng/ul. I also got a perfect sequence when my sample was sent out for sequencing. I designed my primers according to the sequence with about 10 to 20 bp overhang.

I have tried running a gradient (45C to 65C) PCR but I don't get any bands except for the primer and the vector.

These are the primers:
5’ Primer CAATAGGGATCCCAACTTTGTACAAAAAAGTTGGC
3’ Primer GTAGCAGCCTGAGTCGTTATTAGCCAACTTTGTACAAGAAAGTTGG

Any insight would be greatly appreciated! If you need any additional information please let me know.

Thanks!

#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 941 posts
66
Excellent

Posted 07 June 2011 - 10:23 PM

How long is your plasmid? How much of the plasmid you put into the PCR? What is the reason for the overhangs on primers?

In 190ng/ul plasmid there is huge amount of your target sequence, sometimes that may inhibit the reaction, dilluting the plasmid then helps. But I'm still not sure it's the case when I look at the primers, did you ever used them succesfully before? What primers were used for sequencing?
Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

#3 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,803 posts
130
Excellent

Posted 08 June 2011 - 06:19 AM

If you can see a template band on your pcr gel, you are using WAY too much template DNA.  Dilute your template 1000x and try again.  Very likely the PCR reaction is being inhibited.

#4 renee

renee

    member

  • Members
  • Pip
  • 4 posts
1
Neutral

Posted 08 June 2011 - 07:10 AM

View PostTrof, on 07 June 2011 - 10:23 PM, said:

How long is your plasmid? How much of the plasmid you put into the PCR? What is the reason for the overhangs on primers?

In 190ng/ul plasmid there is huge amount of your target sequence, sometimes that may inhibit the reaction, dilluting the plasmid then helps. But I'm still not sure it's the case when I look at the primers, did you ever used them succesfully before? What primers were used for sequencing?


My plasmid is approximately 3kb. I actually tried diluting my plasmid to about 1ng/ul and 30 ng/ul before placing into the PCR reaction but still no band. The overhangs on the primer is for in-vitro expression. For sequencing I used a different set of primers, they are more upstream of my gene of interest. I have never actually tried using this primer on any other clone. I did perform a control on another vector (pSNAP) and it work fairly well, so I know its not my PCR reagents.

Thanks!

#5 renee

renee

    member

  • Members
  • Pip
  • 4 posts
1
Neutral

Posted 09 June 2011 - 07:02 AM

Thanks everyone for your help. I got product after using the Phusion Polymerase and added DMSO.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.