Sudden problems with cDNA PCR using Phusion Polymerase
Started by Ikar, May 21 2011 11:14 AM
9 replies to this topic
#1
Posted 21 May 2011 - 11:14 AM
Hi,
my problem is that I cannot amplify a sequence of interest from my cDNA anymore.
Context:
My plan was to amplify 3 different sequences (genes without stop codons for a TOPO reaction). The
forward primers have a CACC overhang which is required for the topoisomerase.
The lengths are
Gene1: 1630 bp
Gene2: 1935 bp
Gene3: 1207 bp
I tested them by gradient PCR (the gradient was from 45 to 55 °C in 8 steps) to figure out
a appropriate annealing temperature for my primers.
Then I ran a agarose gel and all 3 different sequences were proofed to be amplified.
But one sequence (Gene1, which troubles me now) had very weak bands in the agarose gel.
My PCR program was
30 sec 98°C
15 sec 98°C
15 sec Gradient (45-55°C) }32x Cycles
50 sec 72°C
3 min 72°C
4°C
and I was using Phusion Polymerase. THe composition of a reaction sample was:
27,µl H2O
10 µl 10 HF Buffer
1 µl dNTPs (10 mM)
5 µl forward primer (5 µM)
5 µl reverse primer (5 µM)
1 µl cDNA
0,5 µl Phusion Polymerase
---
Ok. Then I did a second PCR under the same conditions except for the annealing temperature
(I chose 50°C). And after that I directly purified the PCR products by a purification kit (peqlab).
Unfortunately only Gene 2 and 3 worked.
I repeated the experiment with Gene1 but without a positive result.
It seemed that the PCR didn't work anymore.
So I tried the gradient PCR again under the same conditions as before but it didn't work, too.
Weird. I took new primers from the stock and the Phusion Polymerase is also ok (because in my other
experiments it works very good).
What could be the problem?
cDNA seems to be ok
Phusion polymerase is also ok
I took new primers...they should also be ok
dNTPs are also working in my other experiments...
My suggestion would be to take 5 µl of the cDNA instead of 1 µl and
use 0,5 µl DMSO
But maybe you have some ideas why the PCR doesn't work anymore!
Hope to hear from you!
Greets,
Ikar
my problem is that I cannot amplify a sequence of interest from my cDNA anymore.
Context:
My plan was to amplify 3 different sequences (genes without stop codons for a TOPO reaction). The
forward primers have a CACC overhang which is required for the topoisomerase.
The lengths are
Gene1: 1630 bp
Gene2: 1935 bp
Gene3: 1207 bp
I tested them by gradient PCR (the gradient was from 45 to 55 °C in 8 steps) to figure out
a appropriate annealing temperature for my primers.
Then I ran a agarose gel and all 3 different sequences were proofed to be amplified.
But one sequence (Gene1, which troubles me now) had very weak bands in the agarose gel.
My PCR program was
30 sec 98°C
15 sec 98°C
15 sec Gradient (45-55°C) }32x Cycles
50 sec 72°C
3 min 72°C
4°C
and I was using Phusion Polymerase. THe composition of a reaction sample was:
27,µl H2O
10 µl 10 HF Buffer
1 µl dNTPs (10 mM)
5 µl forward primer (5 µM)
5 µl reverse primer (5 µM)
1 µl cDNA
0,5 µl Phusion Polymerase
---
Ok. Then I did a second PCR under the same conditions except for the annealing temperature
(I chose 50°C). And after that I directly purified the PCR products by a purification kit (peqlab).
Unfortunately only Gene 2 and 3 worked.
I repeated the experiment with Gene1 but without a positive result.
It seemed that the PCR didn't work anymore.
So I tried the gradient PCR again under the same conditions as before but it didn't work, too.
Weird. I took new primers from the stock and the Phusion Polymerase is also ok (because in my other
experiments it works very good).
What could be the problem?
cDNA seems to be ok
Phusion polymerase is also ok
I took new primers...they should also be ok
dNTPs are also working in my other experiments...
My suggestion would be to take 5 µl of the cDNA instead of 1 µl and
use 0,5 µl DMSO
But maybe you have some ideas why the PCR doesn't work anymore!
Hope to hear from you!
Greets,
Ikar
#2
Posted 21 May 2011 - 04:09 PM
If you have been freezing the cDNA you may have had degradation... have you tried preparing fresh cDNA?
#3
Posted 22 May 2011 - 01:08 AM
bob1, on 21 May 2011 - 04:09 PM, said:
If you have been freezing the cDNA you may have had degradation... have you tried preparing fresh cDNA?
This was my first thought, too. But I'd like to spare me the laborious RNA extraction and cDNA synthesis if
there is another possibility.
Of course I thawed and freezed it several times, but I used this cDNA probe in other experiments as positive control
in PCR reaction and it did always work. I think that it would be very unlikely that only this particular sequence (gene1) is affected from
degradation.
But due to a general degradation I maybe should use 3-5 µl of my cDNA probe for the PCR sample next time (instead of 1 µl).
#4
Posted 22 May 2011 - 05:39 AM
You could store your cDNA in TE with 50% glycerol at -20, and it would not freeze. The glycerol and TE will have little effect on the PCR reaction.
I think it is more likely that your PCR conditions have slightly changed. Some things to investigate: add 5% 1M Betaine solution,
lower extension temperature to 66. But my number one suggestion would be to redesign the primers, since that is the problem in difficult
PCR more than half the time.
I think it is more likely that your PCR conditions have slightly changed. Some things to investigate: add 5% 1M Betaine solution,
lower extension temperature to 66. But my number one suggestion would be to redesign the primers, since that is the problem in difficult
PCR more than half the time.
#5
Posted 22 May 2011 - 07:29 AM
phage434, on 22 May 2011 - 05:39 AM, said:
You could store your cDNA in TE with 50% glycerol at -20, and it would not freeze. The glycerol and TE will have little effect on the PCR reaction.
I think it is more likely that your PCR conditions have slightly changed. Some things to investigate: add 5% 1M Betaine solution,
lower extension temperature to 66. But my number one suggestion would be to redesign the primers, since that is the problem in difficult
PCR more than half the time.
I think it is more likely that your PCR conditions have slightly changed. Some things to investigate: add 5% 1M Betaine solution,
lower extension temperature to 66. But my number one suggestion would be to redesign the primers, since that is the problem in difficult
PCR more than half the time.
Thanks for the tips.
But I think it is too late for the storage suggestions, because I need this particular cDNA only 1 more time (to amplify this gene sequence).
What is the purpose of the Betaine solution, never heard of it before?
My extension temperature was a gradient from 45°C to 55°C, what do you mean by "lower extension temperature to 66"?
Redesign of primers might be difficult, too. The only option would be making them shorter or longer (because they are
for an amplification of a coding sequence).
The sequences are
[CACC]ATGGAGATCCCGGTTCGA
AGTTGCTATTTTTTCTAATTTCTC
#6
Posted 22 May 2011 - 01:52 PM
Betaine is used for high GC sequences, and allows amplification in difficult cases. You're confusing annealing temperature with extension temperature. I said 66C extension, instead of72. This is important for very low GC sequences. Your annealing temperature gradient sounds as if it ends too low -- I would try 50-65. In general, Phusion likes higher annealing temperatures. I would order some longer primers while trying to sort this out.
#7
Posted 23 May 2011 - 10:59 AM
phage434, on 22 May 2011 - 01:52 PM, said:
Betaine is used for high GC sequences, and allows amplification in difficult cases. You're confusing annealing temperature with extension temperature. I said 66C extension, instead of72. This is important for very low GC sequences. Your annealing temperature gradient sounds as if it ends too low -- I would try 50-65. In general, Phusion likes higher annealing temperatures. I would order some longer primers while trying to sort this out.
Ooops I mixed up apples with pears...
Today - before I read your answer - I tried a annealing gradient from 50-55, used 0.5 µl DMSO and 5 µl cDNA in my PCR sample and it worked. But the result was so bad (very very very weak bands in the agarose gel and even weaker bands after PCR product purification)that I should repeat it.
Maybe I should stick to 72°C extension temperature, because the GC content of the sequence which I want to amplify is 45%. But next time I will definitely try a higher gradient as suggested by you. And - of course - I will isolate fresh RNA and make a new cDNA synthesis. Therefore I would use random primer and oligo-T primer and mix both cDNA samples then.
PS: Do you have a more reliable tool (than vector nti) to calculate primer annealing temperatures?
#8
Posted 23 May 2011 - 12:43 PM
Ikar, on 23 May 2011 - 10:59 AM, said:
Ooops I mixed up apples with pears...
Today - before I read your answer - I tried a annealing gradient from 50-55, used 0.5 µl DMSO and 5 µl cDNA in my PCR sample and it worked. But the result was so bad (very very very weak bands in the agarose gel and even weaker bands after PCR product purification)that I should repeat it.
Maybe I should stick to 72°C extension temperature, because the GC content of the sequence which I want to amplify is 45%. But next time I will definitely try a higher gradient as suggested by you. And - of course - I will isolate fresh RNA and make a new cDNA synthesis. Therefore I would use random primer and oligo-T primer and mix both cDNA samples then.
PS: Do you have a more reliable tool (than vector nti) to calculate primer annealing temperatures?
for phusion always use the Tm calculator at the finnzyme website:
http://www.finnzymes...nation_old.html
you can also try the provided GC-Buffer with DMSO. This can give significantly better results.
In my experience, phusion often worked better when using the gradient protocol (even when I only used one of the gradient temperatures, maybe because of lower ramping rates, i dont know...).
tea-test: The artist formerly known as Ned Land
#9
Posted 24 May 2011 - 10:23 AM
With the Finnzymes tool my TMs were calculated to be 56.3 and 65.9.
Vector NTI suggested me 53.4 and 46.8 and that's why I chose the low gradient 45°C-55°C.
Tomorrow I am eager to try the higher gradient (50-65 or maybe even 55-65). Besides that
I got new cDNA samples synthesized either with random and with oligo dT Primer and tested them
positive by using primers for an housekeeping gene. I will mix them up 50:50 and I'm pretty
confident that this will finally work...
Thank you for your help so far and for the thought-provoking impulses!!
Vector NTI suggested me 53.4 and 46.8 and that's why I chose the low gradient 45°C-55°C.
Tomorrow I am eager to try the higher gradient (50-65 or maybe even 55-65). Besides that
I got new cDNA samples synthesized either with random and with oligo dT Primer and tested them
positive by using primers for an housekeeping gene. I will mix them up 50:50 and I'm pretty
confident that this will finally work...
Thank you for your help so far and for the thought-provoking impulses!!
#10
Posted 26 May 2011 - 11:25 AM
I ran the gradient yesterday and at 62°C the PCR worked. Very weak band in the agarose gel (in comparison to another gene aplified from this cDNA), but it worked














