1 reply to this topic

[chaperones]

Hi,
I have some question about qPCR primers. My primers were designed by using Roche universal probe library and one of them(reverse primer) is complementary to the part of sequence of amplicon but forward primer sequence is consistent with the part of amplicon sequence.- why? Do I get double strand cDNA?

e.g.
L: gttgcgcctctgaccttct
R: cagcttcagtgcctcctca

amplicon: gttgcgcctctgaccttctcgaacaggcagcccatcaaacctgaggaggcactgaagctg


My second question is why initial denaturation step occur? I presume that this is needed for denaturation of duplex mRNA and cDNA but I'm not sure.

Cheers!
Ps. sorry for mistake in the topic, I mean qPCR of course

Edited by chaperones, 11 May 2011 - 08:13 AM.

[tea-test]

this is the basic principle of PCR. one primer binds to the coding strand, the other to the non coding strand. without that you dont get exponential amplification of your DNA.

And it doesnt matter if the cDNA is ss or ds for PCR, if you start with ssDNA it is dsDNA after the first round of PCR.

I recommend you to read some basic literature about PCR for detailed information, just look on the web.

Edited by tea-test, 11 May 2011 - 10:21 AM.