Jump to content


- - - - -

qPCR primer design


  • You cannot reply to this topic
1 reply to this topic

#1 Dr_D

    member

  • Members
  • Pip
  • 2 posts

Posted 30 April 2011 - 06:23 AM

Hi all,

I'm designing primers for qPCR.
I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:

product length = 196
Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3134  C..G..C.C.G.........  3153

Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3329  C......C.C.AG.......  3310


Anyone how would like to share their thoughts on this potential "forward-forward" problem.

Kind regards

Edited by Dr_D, 30 April 2011 - 06:25 AM.


#2 neuropath

    Enthusiast

  • Active Members
  • PipPip
  • 22 posts

Posted 30 April 2011 - 08:43 AM

View PostDr_D, on 30 April 2011 - 06:23 AM, said:

Hi all,

I'm designing primers for qPCR.
I've tried to check the specificity of the primers by blasting them. However, one of the potential off-targets given by Primer-BLAST is:

product length = 196
Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3134  C..G..C.C.G.........  3153

Forward primer  1     AAGCAGAAAACCAGCAGCTC  20
Template        3329  C......C.C.AG.......  3310


Anyone how would like to share their thoughts on this potential "forward-forward" problem.

Kind regards


It is essentially telling you that your forward primer could potentially anneal to 2 sites on the same off-target gene: one site from 3134 to 3153 and the other from 3329 to 3310. There are 4 mismatches in each site and if you choose your annealing temperature properly, it should not cause you any problems.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.