Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Designing a multiple cloning site


  • Please log in to reply
5 replies to this topic

#1 seanspotatobusiness

seanspotatobusiness

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 187 posts
8
Neutral

Posted 27 April 2011 - 09:43 AM

I want to get a short genetic sequence manufactured so that I can put a gene into it. I would like to include a couple of multiple cloning sites and I was wondering whether there was a program which I could input desired enzymes and have it choose an optimal configuration of bases that would enable those enzymes to cut with a minimal number of basepairs (i.e. it would make the target sites overlap as much as physically possible)?

#2 pDNA

pDNA

    Veteran

  • Awaiting Authorisation
  • PipPipPipPipPipPipPipPipPipPip
  • 494 posts
14
Good

Posted 27 April 2011 - 11:30 AM

why do you not use the multiple cloning site e.g. present in pUC19 or pBluescript?

For details on the MCS of pBluescript (containing nearly all common REs) see this [url="[url]http://www.fermentas.com/en/support/technical-reference/phage-plasmid-dna/pbluescriptII"]link[/url][/url]!

Regards,
p

I want to get a short genetic sequence manufactured so that I can put a gene into it. I would like to include a couple of multiple cloning sites and I was wondering whether there was a program which I could input desired enzymes and have it choose an optimal configuration of bases that would enable those enzymes to cut with a minimal number of basepairs (i.e. it would make the target sites overlap as much as physically possible)?



#3 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 385 posts
9
Neutral

Posted 28 April 2011 - 12:43 AM

try GCCACCATGGATCCTCGAGGTACCTGCAGAATTCTAGAAGCTTGCGGCCGC, that gives you the 10 most common (and validated!) RE sites in 51nt. Plus a Kozak site upstream of an ATG. Or can you find something better? ;)
I got soul, but I'm not a soldier

#4 seanspotatobusiness

seanspotatobusiness

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 187 posts
8
Neutral

Posted 28 April 2011 - 03:26 AM

The problem is that existing MCS are of little use because most common restriction sites appear already in my construct. I also want my construct flanked by LoxP and the only way I can see to do this is to get a plasmid manufactured with MCS, followed by LoxP, followed by MCS, followed by LoxP, followed by MCS. Thus I need to design the MCS.

#5 pDNA

pDNA

    Veteran

  • Awaiting Authorisation
  • PipPipPipPipPipPipPipPipPipPip
  • 494 posts
14
Good

Posted 28 April 2011 - 04:03 AM

you can try the genedesigner to design your sequence that you are going to synthesize:

[url="[url]https://www.dna20.com/genedesigner2/"]My[/url] link[/url]

Regards,
p

#6 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 385 posts
9
Neutral

Posted 28 April 2011 - 06:39 AM

I don't really understand... Your question is which RE sites are not in your specific sequence and could be put into your MCS? How should we know that?
I would use Ape for a problem like this...
I got soul, but I'm not a soldier




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.