Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Designing a multiple cloning site


  • Please log in to reply
5 replies to this topic

#1 seanspotatobusiness

seanspotatobusiness

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 139 posts
4
Neutral

Posted 27 April 2011 - 09:43 AM

I want to get a short genetic sequence manufactured so that I can put a gene into it. I would like to include a couple of multiple cloning sites and I was wondering whether there was a program which I could input desired enzymes and have it choose an optimal configuration of bases that would enable those enzymes to cut with a minimal number of basepairs (i.e. it would make the target sites overlap as much as physically possible)?

#2 pDNA

pDNA

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 491 posts
14
Good

Posted 27 April 2011 - 11:30 AM

why do you not use the multiple cloning site e.g. present in pUC19 or pBluescript?

For details on the MCS of pBluescript (containing nearly all common REs) see this link!

Regards,
p

I want to get a short genetic sequence manufactured so that I can put a gene into it. I would like to include a couple of multiple cloning sites and I was wondering whether there was a program which I could input desired enzymes and have it choose an optimal configuration of bases that would enable those enzymes to cut with a minimal number of basepairs (i.e. it would make the target sites overlap as much as physically possible)?



#3 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 374 posts
8
Neutral

Posted 28 April 2011 - 12:43 AM

try GCCACCATGGATCCTCGAGGTACCTGCAGAATTCTAGAAGCTTGCGGCCGC, that gives you the 10 most common (and validated!) RE sites in 51nt. Plus a Kozak site upstream of an ATG. Or can you find something better? ;)
I got soul, but I'm not a soldier

#4 seanspotatobusiness

seanspotatobusiness

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 139 posts
4
Neutral

Posted 28 April 2011 - 03:26 AM

The problem is that existing MCS are of little use because most common restriction sites appear already in my construct. I also want my construct flanked by LoxP and the only way I can see to do this is to get a plasmid manufactured with MCS, followed by LoxP, followed by MCS, followed by LoxP, followed by MCS. Thus I need to design the MCS.

#5 pDNA

pDNA

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 491 posts
14
Good

Posted 28 April 2011 - 04:03 AM

you can try the genedesigner to design your sequence that you are going to synthesize:

My link

Regards,
p

#6 Rsm

Rsm

    Post Dog

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 374 posts
8
Neutral

Posted 28 April 2011 - 06:39 AM

I don't really understand... Your question is which RE sites are not in your specific sequence and could be put into your MCS? How should we know that?
I would use Ape for a problem like this...
I got soul, but I'm not a soldier




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.