5 replies to this topic

[seanspotatobusiness]

I want to get a short genetic sequence manufactured so that I can put a gene into it. I would like to include a couple of multiple cloning sites and I was wondering whether there was a program which I could input desired enzymes and have it choose an optimal configuration of bases that would enable those enzymes to cut with a minimal number of basepairs (i.e. it would make the target sites overlap as much as physically possible)?

[pDNA]

why do you not use the multiple cloning site e.g. present in pUC19 or pBluescript?

For details on the MCS of pBluescript (containing nearly all common REs) see this link!

Regards,
p

seanspotatobusiness, on 27 April 2011 - 09:43 AM, said:

I want to get a short genetic sequence manufactured so that I can put a gene into it. I would like to include a couple of multiple cloning sites and I was wondering whether there was a program which I could input desired enzymes and have it choose an optimal configuration of bases that would enable those enzymes to cut with a minimal number of basepairs (i.e. it would make the target sites overlap as much as physically possible)?

[Rsm]

try GCCACCATGGATCCTCGAGGTACCTGCAGAATTCTAGAAGCTTGCGGCCGC, that gives you the 10 most common (and validated!) RE sites in 51nt. Plus a Kozak site upstream of an ATG. Or can you find something better?

[seanspotatobusiness]

The problem is that existing MCS are of little use because most common restriction sites appear already in my construct. I also want my construct flanked by LoxP and the only way I can see to do this is to get a plasmid manufactured with MCS, followed by LoxP, followed by MCS, followed by LoxP, followed by MCS. Thus I need to design the MCS.

[pDNA]

you can try the genedesigner to design your sequence that you are going to synthesize:

My link

Regards,
p

[Rsm]

I don't really understand... Your question is which RE sites are not in your specific sequence and could be put into your MCS? How should we know that?
I would use Ape for a problem like this...