Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

nested PCR to join amplicons

  • Please log in to reply
No replies to this topic

#1 microbeatic

  • Members
  • Pip
  • 1 posts

Posted 15 April 2011 - 11:18 AM

Hi all,
In the paper "CRISPR Interference Limits Horizontal Gene Transfer in Staphylococci by Targeting DNA" by Marraffini and Sontheimer, they generate a mutant plasmid by inserting a Twort intron from a phage in a specific region of the gene. In the method section, they said they used nested PCR to join the amplicons. Briefly, they PCR amplify the 5' flanking region of sequence of interest (fragment A), and intron from phage (fragment B ), and then 3' flanking region of the sequence of interest (fragment C). The primers were designed in such a way that fragment A has a matching 3' end to 5' end of fragment B, and fragment B has matching 3' end to 5' end of fragment of C. Then, they mention that these amplicons were joined using nested PCR, A and B were joined using nested PCR, and B and C were joined using nested PCR. The two amplicons are then digested with an enzyme and cloned to a vector.

From all this i do not understand how did they use nested PCR to join the amplicons? And, why do they need to have fragment B joined to both A and C?

Any help to understand this'd be greatly appreciated. I am about to pull out all my head.

Here are the primers that they used. Note that the reverse primer of one amplcon is just the reverse complement of forward primer of the other

P15 ggggACAAGTTTGTACAAAAAAGCAGGCTtgaagatagattaaataaaattgagg
P51 cattactgtataaagatacaattatttatatacttcggcatacgttctc
p51rev gagaacgtatgccgaagtatataaataattgtatctttatacagtaatg

P52 gagaacgtatgccgaagtatataaataattgtatctttatacagtaatg
P53 gattcttacctttgtactgatgatttcaattatgttacgaataggttcg
p53rev cgaacctattcgtaacataattgaaatcatcagtacaaaggtaagaatc

P54 cgaacctattcgtaacataattgaaatcatcagtacaaaggtaagaatc
P18 ggggACCACTTTGTACAAGAAAGCTGGGTgttatttaagtggctgggggc

Edited by microbeatic, 15 April 2011 - 11:22 AM.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.