Hello,
I'm trying to design some primers that span introns. However, most of the sequences for my organism (brassica oleracea) are based on Arabidopsis and Refseq are not available. As an example i've been using actin (AF044573.1) with success using these primers, sense: GGTAACATTGTGCTCAGTGGTGGAA antisense: CCTGGACCTGCCTCATCATACTCA. But my went i tried with PAL (HM623311.1) using, sense: TGGATGAGGTGAAGAGGATGGTTGA antisense: CCTGTGCGTTAGATGATCGGTGAA i've got a bigger product than expected (800 bp). So, my question is, if i should try to design primers with Arabidopsis sequences for the same genes or try to do some alignmentand from the consensus make my primers?
Any help will be appreciated,
Thanks
intron spanning primers for non model organisms
Started by adtito, Apr 13 2011 04:30 PM
2 replies to this topic
#1
Posted 13 April 2011 - 04:30 PM
#2
Posted 19 April 2011 - 08:20 PM
What is the purpose of your PCR--detecting mRNA expression?
#3
Posted 30 April 2011 - 05:38 AM
yes it's basically that, my problem is that i have tested my primers on gDNA and work perfectly, but when I go with cDNA synthetized from free gDNA total RNA I'm not getting anything, only my actin control (because of the abundance I think) is working. So I'm guessing that my primers are the problem probably because I'm amplifying an intron, although I'm getting the expected product size that those primers supposed to do on gDNA.
I'm a little loss here.
I'm a little loss here.













