Hello, I will be going through a deep sequencing protocol soon and it lists a series of adapters to use. The 3' adapter has the sequence 5′ AppTCGTATGCCGTCTTCTGCTTGidT 3′ and is called a 3' adenylated adapter. What does the App stand for? What is the GidT at the 3' end? That doesn't look like an adenine to me.
Thank you
Deep sequencing adaptor question
Started by mcb56, Apr 11 2011 12:10 PM
1 reply to this topic













