Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Deep sequencing adaptor question


  • Please log in to reply
1 reply to this topic

#1 mcb56

mcb56

    member

  • Active Members
  • Pip
  • 29 posts
0
Neutral

Posted 11 April 2011 - 12:10 PM

Hello, I will be going through a deep sequencing protocol soon and it lists a series of adapters to use. The 3' adapter has the sequence 5′ AppTCGTATGCCGTCTTCTGCTTGidT 3′ and is called a 3' adenylated adapter. What does the App stand for? What is the GidT at the 3' end? That doesn't look like an adenine to me.

Thank you

#2 mcb56

mcb56

    member

  • Active Members
  • Pip
  • 29 posts
0
Neutral

Posted 11 April 2011 - 12:20 PM

To add to my question, why does the 3' linker need to be adenylated? I am using T4 RNA ligase to add this linker to my RNA fragments.

Thank you




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.