Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Why does T7 RNA transcription start with a GGG?


  • Please log in to reply
5 replies to this topic

#1 Penguin

Penguin

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 64 posts
1
Neutral

Posted 17 March 2011 - 04:17 AM

Hi guys!

I'm doing some revision for my PhD viva next month and am delving in to stuff I'd never thought of (but probably should have!!) before.

My question is why does transcription from a T7 promoter initiate with a GGG? Looking at various papers I think it helps with specificity as G-C pairs melt less readily i.e. T7 binds upstream of the GGG then promotes melting of the 3 G-C base pairs???

Any thoughts? Does anyone know of a great review that has looked at this?

Thanks!
P

#2 pDNA

pDNA

    Veteran

  • Awaiting Authorisation
  • PipPipPipPipPipPipPipPipPipPip
  • 494 posts
14
Good

Posted 17 March 2011 - 09:35 AM

i'm not a specialist ...but is it really that way?

i just know the situation in e.g. pET vectors and there transcription does not start with GGG.

You have an initial reference on that ...maybe it is that way in the T7 phage itself.

Regards,
p

Hi guys!

I'm doing some revision for my PhD viva next month and am delving in to stuff I'd never thought of (but probably should have!!) before.

My question is why does transcription from a T7 promoter initiate with a GGG? Looking at various papers I think it helps with specificity as G-C pairs melt less readily i.e. T7 binds upstream of the GGG then promotes melting of the 3 G-C base pairs???

Any thoughts? Does anyone know of a great review that has looked at this?

Thanks!
P



#3 Penguin

Penguin

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 64 posts
1
Neutral

Posted 18 March 2011 - 01:59 AM

Hi,

I just quickly looked at the sequence of pET3a and the T7 transcription start site does begin with a GGG. pET3a T7 promoter = TTAATACGACTCACTATAGGG, with the GGG being the first 3 nucleotides transcribed (obviously this is not the translation start site which would begin at ATG). As far as I am aware this identical T7 promoter is present in all expression vectors.

P

Edited by Penguin, 18 March 2011 - 02:00 AM.


#4 pDNA

pDNA

    Veteran

  • Awaiting Authorisation
  • PipPipPipPipPipPipPipPipPipPip
  • 494 posts
14
Good

Posted 18 March 2011 - 02:33 AM

you are right ...sorry, i messed it up!

but as a compensation i have an interesting publication for you ...the GGG is part of a 5 base runoff transcript GGGAA that somehow modulates strength of transcription.

For details see this [url="[url]http://www.chem.umass.edu/people/cmartin/Pubs/PDF/Weston%20Pos%20StartSite%20JMB%2097.pdf"]link[/url][/url]!

Regards,
p

Hi,

I just quickly looked at the sequence of pET3a and the T7 transcription start site does begin with a GGG. pET3a T7 promoter = TTAATACGACTCACTATAGGG, with the GGG being the first 3 nucleotides transcribed (obviously this is not the translation start site which would begin at ATG). As far as I am aware this identical T7 promoter is present in all expression vectors.

P



#5 Penguin

Penguin

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 64 posts
1
Neutral

Posted 18 March 2011 - 03:09 AM

Hi again!

Nice paper, it makes sense to me that the preceding TATA allows easier melting of DNA template and the initiating GGG stabilises the transcriptional unit through base-pairing with the template CCC.

Think I can pull off a coherent response if asked about this in my viva now!

Thanks,
P

#6 LabLackey

LabLackey

    member

  • Active Members
  • Pip
  • 29 posts
0
Neutral

Posted 22 March 2011 - 07:38 AM

Reminds me of the GC clamps on primers...




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.