Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Finding Promoter Sequence for gene


  • Please log in to reply
1 reply to this topic

#1 sri2010

sri2010

    member

  • Active Members
  • Pip
  • 19 posts
0
Neutral

Posted 07 March 2011 - 12:57 PM

Hi, I am looking to find the promoter region of a gene...except I am not sure how to get to it. I've read a tons of threads on "how to find promoter region of sequence", but still am confused on how/where to proceed.

Things I have repeatedly read, but have trouble understanding why they work that way:

1)Go to ensemble, look up gene, export sequence ~ first 1000 bp, blast this to make sure you have right region. I dont understand how getting the first 1000 bp will ALWAYS give you the promoter? Then they say put the sequence into primer design program (methylprimer express), and just "assume"? where the CpG islands pop up are..thats where your promoter is? (lets say you have 2 cpg islands..how do you know where the promoter is? is it one of the cpg islands, or does it span both...?)

2) + / - strand... i understand that one is sense (+) the other is (-) antisense strand..but why is it important to incorporate this when you are looking for promoter sequences?

Thanks for your help! (my gene is AXIN2) if anyone wants to show me with screenshots...that would be HIGHLY appreciated! :D

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,160 posts
65
Excellent

Posted 08 March 2011 - 08:21 AM

Here is the -1 kb promoter sequence of human AXIN2 gene. If you can reliably determine the transcription start site, then you know where the promoter is. If you want to analyze DNA methylation of the promoter and there are multiple cpg island, you can just examine the one that is close to the transcription start site or core promoter. You don't need to worry the minus strand.

-1000 AAAAGTTAATTATTCGCTCATAACATAAGGAATCATTCTATAGCAGCAGCAGAATAAATA
CACAATGCTCTGGGTTTGTGACATATTTTCTCATTTTAACGGAGAAGAGAAGGTTGTGTG
TGCCTTATAAACGTTTTTGGGCAAATGTGGGAGAAATTCAAAGGTGACAATGGGGTGAGG
AGTTTTCGATACATTAAAACGGCATGCATGCCTTGTCGTTTGGAGTGGGAAAAAAGATAT
TCCTATCGGTTTAATATGTAACATATGGCAGAAGAGGGGACTTTGGAAGAGTAACGGGTA
TGCAGTTGTTTGGGAGAGATGGCCAATGTGTGCCGCTACGAGGGTCTTATGGCCAGCAGG
TTAGGAAGCTGGACCTAGGTCTTCAGGGCACTGAGGTATGCCTCCTAACTGGTGTTAGCA
CTCAGGCCTATACTGGCGGATTCACACCCCACTTTCACACATGCACAAACGCAATTCATC
CACCAACTGCAGTCCTATATTTACCCGAACTCAGATGCACGTGCACAAGCGCGCACAGGC
ATGCACACGCCTCCAGCGGCTGGGCCCGAGTCCGCCCTATGACAGCGGGCCAGCCAACCC
CAGGGCCGGAACTCCCTTTATAAAGTCCTCCAAGCCCAAATTCCCAGGGAAACTTGAATA
GAGGTAGAAAAGCGTTTGATGATAGAAAAAAAAAAATCTGCTTGCTTGCAGTTCTTGCGA
TGGCCATAATGCTACCAGAAACTGTTGCATTCCAGAGCCGGGGAGAGCGAGGGCAGGCAG
GGGGAGGAGGCGGGAGCAAAGAGGCCGGAGAACTTAAAAGAAGAAATCAGAACTCGGGCT
GAGAATGCCCTCGGGGCCGCGGGGGGCTGGCAGGGGGCGGAGGAGAGGCCGGGGAAGGGT
TAACGCGGGAGCGGAGCGTGCGGCGGGGGCGGGCCGGGGCGGGGCGGGGCGGGCGCGGGG
CGCTGTCCCTTTAAGGCGGGCGGCGCGGGCCGGCCGAGCG  +1 CGGCTGTGATTGGCGCGGCG





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.