Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo

miRNA increases transcription


  • Please log in to reply
3 replies to this topic

#1 peebee

peebee

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 23 February 2011 - 03:05 PM

Hello -

I am studying a miRNA (miR-203) in endometrial cancer. Its reported target is p63, so I did the westerns, and in my cells with high miR-203, there was high p63. When miR-203 is decreased, p63 decreases.
I also checked out what was going on at the level of transcription with qPCR, and found that there was a high correlation (0.9, and significant to 0.02) of a direct relationship between miR-203 and p63...
So it's a little bit confusing.

I've heard of miRs negatively affecting transcription through epigenetic changes, and I would guess this would be possible to increase transcription through epigenetic changes too.
Has anyone seen any publications or heard any news of this?

Much appreciated.
Cheers.

PBody

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 23 February 2011 - 09:27 PM

It is possible that miRNA activates gene transcription by targeting promoter sequences. Here is an example http://www.pnas.org/...105/5/1608.full

But before you can claim that, a lot of experiments need to be done to prove specificity. You can start by searching for targets of miR203 on the promoter of p63.

#3 peebee

peebee

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 17 March 2011 - 08:51 AM

It is possible that miRNA activates gene transcription by targeting promoter sequences. Here is an example http://www.pnas.org/...105/5/1608.full

But before you can claim that, a lot of experiments need to be done to prove specificity. You can start by searching for targets of miR203 on the promoter of p63.



This is a good suggestion, thank you. Do you know how to find out the promoter sequence?

#4 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 18 March 2011 - 10:56 PM

1 kb human TP63 promoter sequence
-1000 TTTTGTGTGTAGACTTTCCTGATATTACACTGATTTGGGAATATATGAACAATTTTATGG
TTTCCTTTCGAAGTAGGTCAAGTCAAAGCAAAACCAAAAACAGCAAAAACTGTAAGACAT
AAAGAATAGAGTGGAGCCGACTGAGAGATTAAAATAAACTAGAATATTTTTATTAACAGG
CAATTTGAAATAATTTGTGCACTTCAGAATATTCTACAATAATATATTATTTCCAATTTT
AATATCTTTAAGAAAATTACTATATTATATGTAAGTACATGTGCATGTGTTTGAGGTAGG
ATATTTAACTCAATAAAGGTTATTTTCTTTTATTCGGGTCAGGCAAAGCTTCTAAGGGGA
TGTGAAAGGGATATCTCTTTCTCTTAGCTGAGAGGAAGAGTGAGTTCTAAGTTAAATATA
ATCAAGGAATTTCCCTGTCTTTGCTATTTGAGATTGTGACCACAACAGGCGGTTGGCTGA
AAGGGAAACTGAAGGGCGGGGAGGGAGGGAAATAGATGAAAAAACAAAACAAAACAAAAC
TTCCCTAAGCAGCTCTACAAAACATTTTAGCCCCAGAAATAGTCACAGAAATCCTCAAAT
CAAACCAGTATCCAGATACAAGGAAGTGTTATGTAGCTGGAGCAGGGTGGACACTCATCA
GCTCAGTTCAGTTACAAAAGTCCAGGCTGCTGAAATTAAACTCTGATGCCATTCATGCCA
GCATCCAATCACGACAGAGATCAGAAGTTCAGAGATGCCTCCAGCTCCAAATTGCCAACA
ACAAGTGTGGCTACTATACGTCAAGGACTCTGAAGCCGTGAGAGAGGGGGAAGAACAACA
GTAGAGAGGATGCCCAGCTGGTAAGAATCGAGTGTTTATGAAGTTTTAGTCAATTGATGA
ATCTCATTGGCTAAAATCAAGAAACGCTCCGCCTCTTTGCAAATATGTATGAAGGAGAGA
AGTGCCTAAACTTCTATGTCTGATAGCATTTGACCCTATT  +1 GCTTTTAGCCTCCCGGCTTT





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.