I designed primers for amplifying a genome fragment from wild type E. coli(K12 and W3899)
The Tm of sense primer is 78C and the antisense Tm is 55C (suggested by the company, but when I calculated by Tm=4(G+C)+2(A+T) , it was both 82C).
I tried again with different annealing temperatures like 72C, 68C, 50C... it all didn't work.
the suquence is as below:
sense: ggatccatgttagtttggctggccg
antisense: aagcttttaacgtaccttcagcgttgcc
Anyone have any suggestions? beside designing new primers? Thanks!!
Question about Primers
Started by Liu Yao, Feb 09 2011 07:59 AM
3 replies to this topic
#1
Posted 09 February 2011 - 07:59 AM
#2
Posted 15 February 2011 - 12:27 AM
Why no one is responding
I already designed new primers, and now I am waiting for them.
I already designed new primers, and now I am waiting for them.
#3
Posted 15 February 2011 - 09:35 AM
Hi Liu Yao,
I'm just trying to help you and never intended to reveal your project.
Well, I guess you are amplifying: phospho-N-acetylmuramoyl-pentapeptide transferase
from the E. coli,
Your sense primer was added with BamHI RE site, and antisense design was added with HindIII RE site
I tried the new calculation by removing the BamHI site and HindIII site:
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 1 19 61.04 52.63 4.00 2.00 ATGTTAGTTTGGCTGGCCG
RIGHT PRIMER 1083 22 63.49 50.00 6.00 1.00 TTAACGTACCTTCAGCGTTGCC
WARNING: Left primer is unacceptable: High 3' stability
WARNING: Right primer is unacceptable: Tm too high/High 3' stability
PCR by try using the gradient range from 55 to 65C. Try add some PCR additives such as DMSO, betaine etc.
I guess you are doing expression studies, but I'm afraid your design might not work. I had read somewhere in the forum, in order for the RE to function, there must be a certain amount of amino acids added before the cutting site. But I couldn't remember exactly the details. Perhaps some senior forum member here can give some info?
EDIT: For my expression studies, I use LIC cloning. I have not use RE method before. Managed to clone 10 genes so far. I recommend you to try this approach.
EIDT 2: Try to check this link... http://www.protocol-...h__1#entry78068
I'm just trying to help you and never intended to reveal your project.
Well, I guess you are amplifying: phospho-N-acetylmuramoyl-pentapeptide transferase
from the E. coli,
Your sense primer was added with BamHI RE site, and antisense design was added with HindIII RE site
I tried the new calculation by removing the BamHI site and HindIII site:
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 1 19 61.04 52.63 4.00 2.00 ATGTTAGTTTGGCTGGCCG
RIGHT PRIMER 1083 22 63.49 50.00 6.00 1.00 TTAACGTACCTTCAGCGTTGCC
WARNING: Left primer is unacceptable: High 3' stability
WARNING: Right primer is unacceptable: Tm too high/High 3' stability
PCR by try using the gradient range from 55 to 65C. Try add some PCR additives such as DMSO, betaine etc.
I guess you are doing expression studies, but I'm afraid your design might not work. I had read somewhere in the forum, in order for the RE to function, there must be a certain amount of amino acids added before the cutting site. But I couldn't remember exactly the details. Perhaps some senior forum member here can give some info?
EDIT: For my expression studies, I use LIC cloning. I have not use RE method before. Managed to clone 10 genes so far. I recommend you to try this approach.
EIDT 2: Try to check this link... http://www.protocol-...h__1#entry78068
Edited by adrian kohsf, 15 February 2011 - 09:45 AM.
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn’t kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn’t kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
#4
Posted 05 March 2011 - 01:35 AM
Liu Yao, on 15 February 2011 - 12:27 AM, said:
Why no one is responding
I already designed new primers, and now I am waiting for them.
I already designed new primers, and now I am waiting for them.
Hi,
You may analyze your primers using NetPrimer. In the program, all the primers are analyzed for primer melting temperature using the nearest neighbor algorithm to ensure accurate Tm prediction. It also provides a rating for the primer, which helps gauging the quality of the oligo.
NetPrimer can be accessed from: http://www.premierbi...imer/index.html
Wilson













