3 replies to this topic

[Liu Yao]

I designed primers for amplifying a genome fragment from wild type E. coli(K12 and W3899)

The Tm of sense primer is 78C and the antisense Tm is 55C (suggested by the company, but when I calculated by Tm=4(G+C)+2(A+T) , it was both 82C).
I tried again with different annealing temperatures like 72C, 68C, 50C... it all didn't work.  

the suquence is as below:

sense: ggatccatgttagtttggctggccg
antisense: aagcttttaacgtaccttcagcgttgcc

Anyone have any suggestions? beside designing new primers?   Thanks!!

[Liu Yao]

Why no one is responding  
I already designed new primers, and now I am waiting for them.

[Adrian K]

Hi Liu Yao,

I'm just trying to help you and never intended to reveal your project.
Well, I guess you are amplifying: phospho-N-acetylmuramoyl-pentapeptide transferase
from the E. coli,
Your sense primer was added with BamHI RE site, and antisense design was added with HindIII RE site

I tried the new calculation by removing the BamHI site and HindIII site:

OLIGO            start  len      tm     gc%   any    3' seq
LEFT PRIMER          1   19   61.04   52.63  4.00  2.00 ATGTTAGTTTGGCTGGCCG
RIGHT PRIMER      1083   22   63.49   50.00  6.00  1.00 TTAACGTACCTTCAGCGTTGCC

WARNING: Left primer is unacceptable: High 3' stability
WARNING: Right primer is unacceptable: Tm too high/High 3' stability

PCR by try using the gradient range from 55 to 65C. Try add some PCR additives such as DMSO, betaine etc.

I guess you are doing expression studies, but I'm afraid your design might not work. I had read somewhere in the forum, in order for the RE to function, there must be a certain amount of amino acids added before the cutting site. But I couldn't remember exactly the details. Perhaps some senior forum member here can give some info?

EDIT: For my expression studies, I use LIC cloning. I have not use RE method before. Managed to clone 10 genes so far. I recommend you to try this approach.
EIDT 2: Try to check this link... http://www.protocol-...h__1#entry78068

Edited by adrian kohsf, 15 February 2011 - 09:45 AM.

[wilson_trace]

Liu Yao, on 15 February 2011 - 12:27 AM, said:

Why no one is responding  
I already designed new primers, and now I am waiting for them.

Hi,
You may analyze your primers using NetPrimer. In the program, all the primers are analyzed for primer melting temperature using the nearest neighbor algorithm to ensure accurate Tm prediction. It also provides a rating for the primer, which helps gauging the quality of the oligo.
NetPrimer can be accessed from: http://www.premierbi...imer/index.html

Wilson