Help with real-time PCR quantification of miRNA
#1
Posted 31 January 2011 - 12:17 AM
I am working on miRNA. I did microarray of miRNA. Now I am trying to do real time quantification of miRNA.
I isolated miRNA from C2C12 cells by using ambian miRNA isolation kit. After that I prepare miRNA First stand by using Clonetech Mir-xTm miRNA First stand synthesis kit, the concentration of miRNA was 3 microgram.
Now I am going real time PCR but I could not find any amplification in other microRNA such as miR-206, -1, 221, 222, 135. But U6 rna amplify very nicely in each case. This kit provide reverse primer with the kit and they recommend whole miRNA sequence can be use as a forward primer.
I tried 3-4 times but i can not get amplification any other miRNA except U6 and some time in miR-135b.
THe PCR condition was used as following 95 C-10sec, 95 C-5 sec, 60 C-20 sec, and other case 95 C-30sec, 95 C-5 sec, 60 C-34 sec.
Could someone tell some suggestion regarding this problem.
Thank you in anticipating
#2
Posted 31 January 2011 - 04:16 AM
MicroRNAQa, on 31 January 2011 - 12:17 AM, said:
I am working on miRNA. I did microarray of miRNA. Now I am trying to do real time quantification of miRNA.
I isolated miRNA from C2C12 cells by using ambian miRNA isolation kit. After that I prepare miRNA First stand by using Clonetech Mir-xTm miRNA First stand synthesis kit, the concentration of miRNA was 3 microgram.
Now I am going real time PCR but I could not find any amplification in other microRNA such as miR-206, -1, 221, 222, 135. But U6 rna amplify very nicely in each case. This kit provide reverse primer with the kit and they recommend whole miRNA sequence can be use as a forward primer.
I tried 3-4 times but i can not get amplification any other miRNA except U6 and some time in miR-135b.
THe PCR condition was used as following 95 C-10sec, 95 C-5 sec, 60 C-20 sec, and other case 95 C-30sec, 95 C-5 sec, 60 C-34 sec.
Could someone tell some suggestion regarding this problem.
Thank you in anticipating
not easy with these info. how about the Ct of U6? maybe the problem is that you are not using enough RNA. if u have a good amplification of U6 at high Ct that makes it. in alternative try using Applied biosystem assays, they work just fine.
bye Fiz
#3
Posted 31 January 2011 - 10:29 AM
Also, although there are "special" kits for miRNA isolation, I am very skeptical of them as most columns actually don't bind RNA<200nt very well. I think its better to just isolate total RNA and then do RT reaction versus trying to isolate small RNA. If your mastermix and PCR program is stringent enough you should only be amplifying miRNA and not other RNA anyways.
Here's a link to some pre-designed miRNA primer sets, unfortunately it is not compatible with competitor cDNA synthesis kits as they too use a universal reverse primer. http://www.abmgood.c...11839&dsn=12258
I should add that trying to isolate small RNA over total RNA may skew the levels of less prominent miRNA species...
Edited by biotechgirl, 31 January 2011 - 11:00 AM.
#4
Posted 07 February 2011 - 12:18 AM
biotechgirl, on 31 January 2011 - 10:29 AM, said:
Also, although there are "special" kits for miRNA isolation, I am very skeptical of them as most columns actually don't bind RNA<200nt very well. I think its better to just isolate total RNA and then do RT reaction versus trying to isolate small RNA. If your mastermix and PCR program is stringent enough you should only be amplifying miRNA and not other RNA anyways.
Here's a link to some pre-designed miRNA primer sets, unfortunately it is not compatible with competitor cDNA synthesis kits as they too use a universal reverse primer. http://www.abmgood.c...11839&dsn=12258
I should add that trying to isolate small RNA over total RNA may skew the levels of less prominent miRNA species...
thank you very much for ur reply. Actually the Ct value U6 are between 10 and 15.
#5
Posted 08 February 2011 - 12:31 PM
MicroRNAQa, on 07 February 2011 - 12:18 AM, said:
biotechgirl, on 31 January 2011 - 10:29 AM, said:
Also, although there are "special" kits for miRNA isolation, I am very skeptical of them as most columns actually don't bind RNA<200nt very well. I think its better to just isolate total RNA and then do RT reaction versus trying to isolate small RNA. If your mastermix and PCR program is stringent enough you should only be amplifying miRNA and not other RNA anyways.
Here's a link to some pre-designed miRNA primer sets, unfortunately it is not compatible with competitor cDNA synthesis kits as they too use a universal reverse primer. http://www.abmgood.c...11839&dsn=12258
I should add that trying to isolate small RNA over total RNA may skew the levels of less prominent miRNA species...
thank you very much for ur reply. Actually the Ct value U6 are between 10 and 15.
Ct between 10 and 15 is very early... Did you run your samples on a gel? Ct values this early are suspect for primer dimer in my experience, or for contamination. Since your endogenous control is so low its almost as if there aren't any or very very low levels of those miRNA species you are probing for. However, that seems very unlikely because usually you have the opposite problem where there is amplification where there should be none. Sounds like something is wrong with your primers or with your mastermix.
#6
Posted 21 February 2011 - 11:24 PM
I run the sample on gel, except U6, there was not any other band by other primer.
I repeat the experiment, by increasing the RNA concentration and also this time i chosen the time point at which the expression of miRNA is greater, for example i grow C2C12 cells in myogenic media till 5 days, where most of myogenic realted miRNA (miRNA-1, 133b, 133a, 29a, etc) expression is already reported. This time i isolated total RNA by mirVANA miRNA isolation kit, i used 5ug RNA for cDNA prepation. But still i could not find any amplification.
I used following sequence as a forward primer
Primers for microRNA
Primer name sequence
1 mmu-miR-1 F UGGAAUGUAAAGAAGUAUGUAU
2 mmu-miR-133a F UUUGGUCCCCUUCAACCAGCUG
3 mmu-miR-206 F UGGAAUGUAAGGAAGUGUGUGG
4 mmu-miR-135a F UAUGGCUUUUUAUUCCUAUGUGA
5 mmu-miR-29a F UAGCACCAUCUGAAAUCGGUUA
6 mmu-miR-29b F UAGCACCAUUUGAAAUCAGUGUU
7 mmu-miR-133b F UUUGGUCCCCUUCAACCAGCUA
8 mmu-miR-221 F AGCUACAUUGUCUGCUGGGUUUC
9 mmu-miR-222 AGCUACAUCUGGCUACUGGG
The PCR condition is as follow
Denaturation
–– 95°C 10 sec
• qPCR x 40 Cycles
–– 95°C 5 sec
–– 60°C 20 sec
• Dissociation Curve
–– 95°C 60 sec
–– 55°C 30 sec
–– 95°C 30 sec
Do u think there is some problem in primers. If u have any suggestion please let me know.I tried to send my resylt but it could not uploaded.
Thank you very much
#7
Posted 22 February 2011 - 04:19 PM
MicroRNAQa, on 21 February 2011 - 11:24 PM, said:
I run the sample on gel, except U6, there was not any other band by other primer.
I repeat the experiment, by increasing the RNA concentration and also this time i chosen the time point at which the expression of miRNA is greater, for example i grow C2C12 cells in myogenic media till 5 days, where most of myogenic realted miRNA (miRNA-1, 133b, 133a, 29a, etc) expression is already reported. This time i isolated total RNA by mirVANA miRNA isolation kit, i used 5ug RNA for cDNA prepation. But still i could not find any amplification.
I used following sequence as a forward primer
Primers for microRNA
Primer name sequence
1 mmu-miR-1 F UGGAAUGUAAAGAAGUAUGUAU
2 mmu-miR-133a F UUUGGUCCCCUUCAACCAGCUG
3 mmu-miR-206 F UGGAAUGUAAGGAAGUGUGUGG
4 mmu-miR-135a F UAUGGCUUUUUAUUCCUAUGUGA
5 mmu-miR-29a F UAGCACCAUCUGAAAUCGGUUA
6 mmu-miR-29b F UAGCACCAUUUGAAAUCAGUGUU
7 mmu-miR-133b F UUUGGUCCCCUUCAACCAGCUA
8 mmu-miR-221 F AGCUACAUUGUCUGCUGGGUUUC
9 mmu-miR-222 AGCUACAUCUGGCUACUGGG
The PCR condition is as follow
Denaturation
–– 95°C 10 sec
• qPCR x 40 Cycles
–– 95°C 5 sec
–– 60°C 20 sec
• Dissociation Curve
–– 95°C 60 sec
–– 55°C 30 sec
–– 95°C 30 sec
Do u think there is some problem in primers. If u have any suggestion please let me know.I tried to send my resylt but it could not uploaded.
Thank you very much
Are these your primers exactly? You are annealing against cDNA not RNA right? Your primers are in the form of RNA.
When you run your gels are they clean? Or are there smears at all?
In my experience, a one step qPCR program doesn't always amplify miRNA targets that well. Are you searching for mature sequences or precursor?
You are probably better off just buying a primer/mastemix set specific for miRNA at this point. Its hard to say what the problem is, but its probably to do with a poor primer design and mastermix formulation.
miRNA are pretty small, so there's a lot more optimizing to get good efficiency and to get good specificity.
Also, what mastermix are you using for your qPCR? Did you check that all the settings are correct and that there's a reference dye include if needed?
Edited by biotechgirl, 22 February 2011 - 04:20 PM.
#8
Posted 24 February 2011 - 01:37 AM
Yes this is my primers.
As recommended in the protocol manual "We recommend that the entire sequence of your mature miRNA (21–23 nt) be used as your miRNA-specific, 5’ primer".
i used primer as given in the list ( i.e as RNA olig).
I am annealing against cDNA. Because these primers are mature miRNA sequences, so the amplification should be mature miRNA.
I just want to know either we can used oligoRNA sequence as a primer or we should change into DNA oligo for the primers.
Please let me know If I did wrong. specially for primer sequences.
thank you
Are these your primers exactly? You are annealing against cDNA not RNA right? Your primers are in the form of RNA.
When you run your gels are they clean? Or are there smears at all?
In my experience, a one step qPCR program doesn't always amplify miRNA targets that well. Are you searching for mature sequences or precursor?
You are probably better off just buying a primer/mastemix set specific for miRNA at this point. Its hard to say what the problem is, but its probably to do with a poor primer design and mastermix formulation.
miRNA are pretty small, so there's a lot more optimizing to get good efficiency and to get good specificity.
Also, what mastermix are you using for your qPCR? Did you check that all the settings are correct and that there's a reference dye include if needed?
[/quote]
#9
Posted 16 March 2011 - 03:50 PM
Yes, you must use DNA sequences, not RNA. The efficiency and reliability should improve then.













