Jump to content


- - - - -

A Puzzle for Molecular Biologists


  • You cannot reply to this topic
8 replies to this topic

#1 antibodymania

    Enthusiast

  • Active Members
  • PipPip
  • 27 posts

Posted 25 January 2011 - 01:38 PM

The Central Dogma of Molecular Biology...and how to have fun with it. Help Josh decode the password to John's computer by using molecular biology techniques. This puzzle is sure to exercise your mind...in a geeky sort of way.

How much do you know about Central Dogma of Molecular Biology: a Puzzle to exercise your mind

#2 Adrian K

    Legendary Graduate Beggar

  • Active Members
  • PipPipPipPipPip
  • 886 posts

Posted 26 January 2011 - 10:50 PM

ATGTACATGATCGACGACCTAGAGAATGCTATGGAA

Translated:
MYMIDDLENAME

Answer:
Smith
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn’t kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA. Do it."---phage434

#3 gt_ameya

    Rervm Cognoscere Cavsas

  • Active Members
  • PipPipPipPipPip
  • 477 posts

Posted 27 January 2011 - 02:00 AM

Adrian,

Your posting of the answer deters people from even clicking on the link above.

Its like having results without even reading the hypothesis....
Read the recent post on my Blog

Image copyright: Adrian Koh SF.
Replication of this art is strictly prohibited without express permission of the artist

We should get more holidays!

#4 Adrian K

    Legendary Graduate Beggar

  • Active Members
  • PipPipPipPipPip
  • 886 posts

Posted 30 January 2011 - 03:14 AM

Ops, my bad... sorry... I shall removed it...

p/s: how come I can't edit the post?

Edited by adrian kohsf, 30 January 2011 - 03:16 AM.

Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn’t kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA. Do it."---phage434

#5 casandra

    carpe diem by the jugulum

  • Active Members
  • PipPipPipPipPip
  • 16,648 posts

Posted 30 January 2011 - 05:18 AM

View Postadrian kohsf, on 30 January 2011 - 03:14 AM, said:

Ops, my bad... sorry... I shall removed it...

p/s: how come I can't edit the post?

because there's a time limit for editing and deleting a post, I think...perhaps 1 to 2 days post-posting (or we can try to find out here with this post)...:) and probably only the great panda, the admin and the mods can do something to it afterwards....

Edited by casandra, 30 January 2011 - 05:26 AM.

"Oh what a beauteousness!"
- hobglobin, personal comment about my beauteous photo......

#6 antibodymania

    Enthusiast

  • Active Members
  • PipPip
  • 27 posts

Posted 15 February 2011 - 11:05 AM

woohoo! congrats to Adrian for getting the answer!

#7 Adrian K

    Legendary Graduate Beggar

  • Active Members
  • PipPipPipPipPip
  • 886 posts

Posted 15 February 2011 - 09:57 PM

LOLx... got price for me?
^_^
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn’t kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA. Do it."---phage434

#8 antibodymania

    Enthusiast

  • Active Members
  • PipPip
  • 27 posts

Posted 16 February 2011 - 02:09 PM

View Postadrian kohsf, on 15 February 2011 - 09:57 PM, said:

LOLx... got price for me?
^_^


Hmm...well you can get free stuff (including gift cards and other fun science-y stuff) from the site by submitting antibody reviews! ;)

#9 Adrian K

    Legendary Graduate Beggar

  • Active Members
  • PipPipPipPipPip
  • 886 posts

Posted 16 February 2011 - 02:52 PM

View Postantibodymania, on 16 February 2011 - 02:09 PM, said:

View Postadrian kohsf, on 15 February 2011 - 09:57 PM, said:

LOLx... got price for me?
^_^


Hmm...well you can get free stuff (including gift cards and other fun science-y stuff) from the site by submitting antibody reviews! ;)


Hmn... too bad. My work doesn't involve using any antibody.. I'm a total immunology handicapped/ignorant.
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.

..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...

"what doesn’t kill you, makes you stronger"---Goddess Casandra reminds me to be strong

"It's all just DNA. Do it."---phage434





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.