The Central Dogma of Molecular Biology...and how to have fun with it. Help Josh decode the password to John's computer by using molecular biology techniques. This puzzle is sure to exercise your mind...in a geeky sort of way.
How much do you know about Central Dogma of Molecular Biology: a Puzzle to exercise your mind
0
8 replies to this topic
#2
Adrian K
-
- Global Moderators
-
- 684 posts
Legendary Graduate Beggar
24
Excellent
Excellent
Posted 26 January 2011 - 10:50 PM
ATGTACATGATCGACGACCTAGAGAATGCTATGGAA
Translated:
MYMIDDLENAME
Answer:
Smith
Translated:
MYMIDDLENAME
Answer:
Smith
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
#3
Ameya P
-
- Moderators
-
- 269 posts
Rervm Cognoscere Cavsas
13
Good
Good
Posted 27 January 2011 - 02:00 AM
Adrian,
Your posting of the answer deters people from even clicking on the link above.
Its like having results without even reading the hypothesis....
Your posting of the answer deters people from even clicking on the link above.
Its like having results without even reading the hypothesis....
NEW!!!! Does lack of plants mean End of Photosynthesis on Earth on CoffeeTableScience!!!!
Image copyright: Adrian Koh SF.
Replication of this art is strictly prohibited without express permission of the artist
Image copyright: Adrian Koh SF.
Replication of this art is strictly prohibited without express permission of the artist
#4
Adrian K
-
- Global Moderators
-
- 684 posts
Legendary Graduate Beggar
24
Excellent
Excellent
Posted 30 January 2011 - 03:14 AM
Ops, my bad... sorry... I shall removed it...
p/s: how come I can't edit the post?
p/s: how come I can't edit the post?
Edited by adrian kohsf, 30 January 2011 - 03:16 AM.
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
#5
casandra
-
- Active Members
-
- 5,007 posts
carpe diem by the jugulum
51
Excellent
Excellent
Posted 30 January 2011 - 05:18 AM
adrian kohsf, on 30 January 2011 - 03:14 AM, said:
Ops, my bad... sorry... I shall removed it...
p/s: how come I can't edit the post?
p/s: how come I can't edit the post?
and probably only the great panda, the admin and the mods can do something to it afterwards....
Edited by casandra, 30 January 2011 - 05:26 AM.
"Oh what a beauteousness!"
- hobglobin, personal comment about my beauteous photo......
- hobglobin, personal comment about my beauteous photo......
#6
antibodymania
-
- Active Members
-
- 27 posts
member
9
Neutral
Neutral
Posted 15 February 2011 - 11:05 AM
woohoo! congrats to Adrian for getting the answer!
#7
Adrian K
-
- Global Moderators
-
- 684 posts
Legendary Graduate Beggar
24
Excellent
Excellent
Posted 15 February 2011 - 09:57 PM
LOLx... got price for me?
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
#8
antibodymania
-
- Active Members
-
- 27 posts
member
9
Neutral
Neutral
Posted 16 February 2011 - 02:09 PM
adrian kohsf, on 15 February 2011 - 09:57 PM, said:
LOLx... got price for me?
Hmm...well you can get free stuff (including gift cards and other fun science-y stuff) from the site by submitting antibody reviews!
#9
Adrian K
-
- Global Moderators
-
- 684 posts
Legendary Graduate Beggar
24
Excellent
Excellent
Posted 16 February 2011 - 02:52 PM
antibodymania, on 16 February 2011 - 02:09 PM, said:
adrian kohsf, on 15 February 2011 - 09:57 PM, said:
LOLx... got price for me?
Hmm...well you can get free stuff (including gift cards and other fun science-y stuff) from the site by submitting antibody reviews!
Hmn... too bad. My work doesn't involve using any antibody.. I'm a total immunology handicapped/ignorant.
Expecting the world to treat you fairly because you are a good person is like expecting the lion not to attack you because you are a vegetarian.
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
..."best of our knowledge, as far as we know this had never been reported before, though I can't possible read all the published journals on earth, but by perform thorough search in google, the keywords did not match any documents"...
"what doesn't kill you, makes you stronger"---Goddess Casandra reminds me to be strong
"It's all just DNA. Do it."---phage434
